Description :
From Genome Similarity Track
Location :
Scaffold_8:236561- 241291
Transcript NameFunction/comments
Phyci_2313Hypothetical protein
Phyci_212021conserved hypothetical protein
Phyci_301524Hypothetical protein
Phyci_2120023-oxo-5-alpha-steroid 4-dehydrogenase, putative

Sequence
4730 bases(100 bases per row)
GCGCCAGCGCGAGCAGGAGCTGGTCGTGGTCTCGGACGAGGTGCCGCTCGCAGACATGCAGCGCGAGGTGCTGGACGAGGACGAGGTGCTGTTCACGCAC
CAGTGCCGCTGCGGAGAGCTGTACGAGGTCACGGACGAGGAGCTGCAGGACGGCGTGGACGTGGTGCCCTGCACGGGCTGCTCGCTGCACATCCGCGTGC
TGCGGGGCAGCGCGTCCTGATAAATGCTGCAGGCGCTGGGGGAATATAAAACTTTCATTGTGCTTTGCATGCTTCCTGCCTCTCGATGCGACCGACGTCC
TGGCGGCTTTTGCTCGCTGCTGGTGCTTATGAGGACGAGCAATTAGAACTCCTTGCCGCGCGGGGCTCCGTGCGACGGGTATCTCTGCGGCGTCTGGATC
TGGTGCAGCACGCCCAGACCGATGTACGCCATAAAGATGAAGAGCATACCAAAGAGAAGGCCCGCCATGATGTCGGGCGTGATGTTCACGTAGTGCGAGA
AGCAGAAGGCCTTGCCCGCCGCGCTGTAGCCAACGAGGTAGCCCGCTTCGCACAGAATCGCAGCCTCGACGGTCGCGTTGGTTTTCTTGGCCTTGGCCTG
CGCCGAGAGGCGACGCGCCAGAGGGTCCTGCAGCTCCACCGAGCTGGCGTCGTTGCCAGTAAGGCCAAAGTCCGTCTTGCCACCAGTGGCGGCGTTGAGG
CTGCTCGACGCCGTCTGGATCGCGGCGTCCACGTCGGGCAGTGTCATGTCCTCCGGGAGCTGCACCACCAGCAGGTCCGTCTTGCCGTCGGAGAGCAGCG
TCTTGCCCTCCGCGGAGGCGATAAACACGTCCAGGTCCTGCGCGGCCACGATGTGCGGCTGGGCACTCGTCATCTCGGGCAGCAGCGGCTTGGTGCGCGT
GGAGTGCGGGATCACCACCGACGACTTGGCGCTCTGCACGGCGTTCTGCACGAAGGACGTCTGCTCCGCCGCTCTAGCGAGCTGGGAGACGTCGTCCGAG
GTCAGCGACGGCAGCAGGAAGAGACACAGCACCTCCGACGGCTGCGACGAAGAGAGCTGAGTGCTCAGCACGCCCTAATAGGAGCAACAACGACGGTTAT
CAGCTTGAATTGAGTCTCGGAAGACAATCCGCAGACACCGACGCACCTCCTTGTCAGCGCTCGCGTCGCGCGAGAGCACGCGCTGCACAGCGGACGCCAC
CGCGGCCTCGTCCATCTCGGAGCTCAGGTAAGCGTTCGACCCGGCGAACACGCTGCACGGAGGACAGACACACAGCGAAGAGCTCTGTAAGATCCACAAT
CGAGAGATAATAAAGGGAGAAATGGGGGCGAGACGCACGGGCTCTGGGACCACAGCAGCACCGGCACGTGGGGGAACAAGGTGGCGGCCGACACAGCCGA
CGTCGCAGCCGCCAGGCCGCACAGCGCGGCGCCCAGCAGCGTCCTCATCTTGGAACTGATACTCGGCGCTTCCTCGCCGCTTAGGATCGCTCCTCTGTCC
GTTTCTGTTTTTCCCCACACGGCGTTAGTATGGGAGGTGGCGCGAAGGTCGCTCCAGCTTGGCGCAACATGCCCCCTTTTTCCAGCGATTCGTGGCTCAC
TCCACGAAGAAACCCGCAGGTACGAACGACCGCCGGCTCTCCGACGTTCCCAGAGCCCGCGCTGACCGCCGCCTGCCTCCCCGTTGCTCTGTGCGCAGTG
ACCCAGCGACCAATAGAGACCCCAGTGCAAGATGTCGTCCATCCTCGCCTCCCTCGACATGAGCCTGGACGACCTCATCGCTCAGAAGAAGAGCCGCGCC
TCCAACCCGGCGTCGCGCCCGGCCAGAGCCAACAAGGACAAGGACGCGGCCCCCGGCCCCATCCGCGGCGGCCGCCGACGCAACCGCGGCCGCAACCAGC
CCTACTCGCGCTCCGTAAGTGTGGCGGCCTGACCTGAGCGGAAGGTCGACCGTATCCTTCTCTCTACGTGCCGTCCTCCTCCTCTCGTGCCTCCCTCCGC
GGTCTCTTGGATGGACCTGGCAGGACTTCCACTCCCCCCTCCCTCTGCGGGGAGCTCGGCGCCCTGTCGAGCCTGGATGTTGCTGCAGCGGGCGGGGACG
GACGTTTCGTTGCGTTGGTGGACCGAAATTTTCACACGTGGCTTTGCTTCTTCTCCCTGCTGCTTGTCCCAAAGCGCGGCGACGACGACGATGACATGGA
CGTCGACCTGGACGACGCCCCCGACAGCGGCAACAGCCGCGGCGGAAAGAAGCGCTCCGTGGTGGTCAAGAAGCCCGGCAACAATGGCGGCAAGAAAGGT
GCGACGCGACGATCTATCTACGTGCGGTGACGAGACCAGGCCTTTACTGACGCGTCGGTTGACGGTTGTCCTGCAGGCGGCTCGTCCTCCATCCTGTCGC
GTCTCGGCGGCAAGGACGCGGCCAGCCCCGGCACGAAGATCCTGGTGAAGAACCTCAAGTTCGACATCCTGGAGGAGGAAGTGCGCGAGCTCTTCGGCAC
GGTGGGCAAGGTGTCCAAGGCGGAGATTGTGTACGACCGCTCCGGCCGCTCCAAGGGCATCGCGCGCGTCTGGTTCGCCCGCCGCTCGGACGCAGACAAG
GCCATCAAACAATACGATGGTACGACGACTCTCTGCGCATGTGATGGATTTTAGCTGGACGCTAAGCGTTTGGGGATGTGTAGGACGCACACTGGACGGA
CAGCCGATGCAGATCACGCTGGACTCGGACAAGAATGTTCGCAACGGACTGTTCGGCACGGCGCTTGAGCGTGACGACAAGGATGTGAAGTTCAAGGTCT
CCTTCGGGTAGGGCGTCATTGATGCACGCATCGATTTAGCTGGGTATGGGGTCTGATCGTAGTCTCGTGCTTTATGCAGTGGCAACAACGACAATAACGA
CCAGCAGAAGGGCCGCCGCAACAGACGTCGCGGACGCAACGATAAGGACAGCCAGGGGTATGCTTGTTAATGCTTCATAGCTGCTACTGTGGAAGGTGGT
CTGACATCTGTGTTATTCTCTTTGTGCCGCAGCGGCCGTGGTAAGGATACTGCTCCGTCCAAGACAGCTGAAGAACTGGACAACGAGATGGACACTTACA
TGAAGGACGCATAAACGTGAAGTCGATGCGCATCCAACATGATGCTCGTCTTCGGCTGGAACGTCAAGCTTGAGACCATGCATAGTTGTTTTGGTACATT
GCATTTAACGGGTGTGCGTGTTCGCCACGTTCAGCAGAGCGAGTGATCGAATGTTTGAAGTGCCGCCGACACGTGGAATGACGGTGGATGAAAGACTTCT
CGCGACACGCTCCCCTATTTGAATAAAGCATCCCCATGACCCTGAAAACGGATTCCTGGCGAAGGTGTGTGCCCCGTAGCGCCAACGCTGTGGCCCGAGA
ACTACCTGCCGCTGGAACGAAGTCCTGTGCTGTTGCCGGTTTTATCGTGCGTTGTGCTGATCCAAGATTGGTCCAAGTCCGTCAAGTAAAGCCACGCCGA
CTTGCCGACTGGAACGATTCTCCAGCGTGGACGTGGCCCACTTGCTCGACCGTTGTGGATCTGGCGTAGCTTTAGCAATAGGACAGCTATCAGGAAATAC
CGTTGACTACAGGCCAGTGACGAGTGCCGTTGCAAAACACTAATAGAACGACGCACTGTGGGATCGGTGACATTCAGCGAGAATAACTGCGTGTGCAGGC
TGCCGTTGGCAGCAATTTGCTGCATTGCTCGCTATGGCGAATGGAAGTGAAGGTATCCGTATAGAGTATATCCACTATGTAGCTGATTGGTTGCTGTCGG
ATAGACATTGCCATTTTGACGTTCACACATCACGATGGACGTGCTCGGTATCAAGACGGAGGAAGAGCTGCATGCGTGGCTGGTGAAGGGGGTGTTCGCG
CTAGGCGTGGTGACGTACGTGGCGACGACCGTCATCACTGCACCCTACGGACGCCACGTTCGGCCCGGGTGGGGACCAACGGTGAACACGCGCCTCGGCT
GGGTCTTGATGGAGAGCCCGTCGGCCGTTTGGTTCGCGATCGTGTACTCGTGGGGCGAGCACCGCTCGGAAACAACCCCGCTCATCGCCGCAAGCTTGTG
GGGGTGCCACTACGTCTACCGGTCGTACATCTACCCGTTCCTCATTCGCGCCAGCAAGGACAAACGCATGCCGCTGACCGTGATGCTCTCTGGGGACTTC
TACAACATGGTCAACGCGTACATCAATGCTCGGTACCTGAGCCAATTCGGCGACTACAGCGGGGACGACACGTTTTCACGACCCTCGTTCTACGCTGGCG
TCGCTCTCTTCGTGTTCGGTCTGTCGATGAACATCTACTCTGACCAAGTACTGATCAGTCTGCGCAAACCTGGCGAGTCGGGCTACAAGATTCCCCACGG
AGGCCTGTTCGAGTTCGTTTCGTCGCCCAACTACCTGAGCGAGCTGCTGGAGTGGACGGGCTGGACGTTGCTGTCTCAATCGCCCGCAGGCCTGTCGTTC
GCTGTGTACACCGCCACGAACCTCATCCCCCGGGCTCTGAGCAACCACCGCTGGTACCAAGACAAGTTCCGCGACGAGTACCCGGCAAACCGCCGAGCGA
TCATCCCGTTCCTGTGGTAGCCGCCGGCAAATAATCCGTAAAAGTCTACGGATAGCGATCTTCGAGCCTCAATTGGACTTCCACTTCAACTCCAGTATCT
TTGTTTCTTGTGCAGTGCGGCTCATTGCCA