Description :
From Genome Similarity Track
Location :
Scaffold_77:236511- 238627
Transcript NameFunction/comments
Aphas_H257_15554heat shock protein 101

Sequence
2116 bases(100 bases per row)
GCGGCCGCCCTGTGACGGGGCAAAACGCAGAGTCGAACTACGAAGCCCTGAAAAAATACGGGCAAGACTTGGTGGAGCTCGCGGCAGCTGGGAAGATTGA
CCCGGTGATTGGCCGTGACGAAGAAATCCGCCGCACAGTGCGCATTTTGTGTCGTCGTACGAAGAACAACCCCGTGTTGATTGGCGAGCCTGGTGTCGGG
AAGACGGCCATTGTCGAAGGCCTGGCCCACCGCATTGTCCTGGGCGACGTTCCGGAGTCCATTGCGCAATGCCACGTCATTTCATTGGATTTGGGGGCTC
TGATTGCCGGCGCCAAGTACCGCGGTGAGTTTGAAGAGCGATTGAAGGCGGTACTGAAGGAAGTGCAAGACAGCGATGGCAAGATCATTTTGTTCATTGA
CGAAATGCACTTGATCCTGGGAGCAGGGGCTACGAGCGGTGCGATGGACGCTGCCAACTTGTTGAAACCCATGTTGGCCCGCGGTGAGTTGCGCTGCATT
GGAGCCACGACCTTGGAAGAATACCGCAAGCACGTGGAAAAGGACAAGGCGTTTGAACGCCGGTTCCAACAAGTCATGGTGAAGGAGCCGTCCGTTGAAG
ACACGGTGAGCATTCTCCGAGGGCTGAAGAGTCGCTACGAGTCCCATCATGGCGTGGCCATCACGGATGGTGCATTGGTGGCTGCGGCGACATTGGCAGA
CCGCTACATCACGGAACGTTTCATGCCGGACAAGGCGATTGATTGCATTGACGAAGCGTGCGCGAACGTGCGCGTGCAGCTGGACTCGCAGCCAGAGGTC
ATTGACGCGTTGGAGCGCAAGCAACTTCAGCTGCAAGTGGAAGCGACGGCGTTGGCCAAGGAGAAGGACAGCCGGTCGAAGGATCGTCTGAAAGTGGTGC
GACACGAGCTGTCCCAAGTCCAAGACCAATTGACCCCCCTGGTACTACAACATCAAGGCGAGAAGGAAAAAGTGAACGAACTTCGCCGCCTCAAGGACAA
GTTGAACGCGTTGCACTTAAAGGTGAGCCAGGCCGAGCGCAAGGGCGATTTGGCGCAGGTGGCGGATTTGAAGTACTATGCGATTCCCGATGTTGAGCGA
ACTTTGAAACGACTGGAGACGGAAAAGGCCAACGACACTCAAGCGAATCGACTGGTGGAAGAAGTGGTGCGCGAAGACCAGATTGCTCAAGTCGTGGCTC
GATGGACGGGCATCCCAGTCGACAAGCTGACCACGAATGCCAGCGACCGCCTCTTGCACCTGGCTGATCGCCTTAATCAACGCGTGGTCGGGCAAGCCAG
CGCCGTGGAAGCCGTGTGTGACGCCGTTTTGCGTTCCCGTGCAGGTTTGAGTCGTCGCGATCAACCCACGGGGTCGTTTTTGTTTTTGGGCCCCACGGGG
GTGGGCAAGACGGAGTTGGCGAAAGCGTTGGCGCTGGAATTGTTCGACTCGGAAAAGCACATGGTGCGCATCGACATGTCGGAGTTTATGGAAGAGCACT
CGGTGTCCAAATTGCTCGGTGCCCCTCCTGGCTATGTGGGCTACGACGACCAAGGCGGCCAGCTGACCGAACCCATTCGCCGCAACCCGTACAACGTGGT
ATTGCTAGACGAGATTGAAAAGGCTCACCCCAAGGTGCTCAACGTGTTGCTGCAATTGCTGGACGAAGGCCGCCTGACAGATTCCCACGGGCGATCGGTG
GACTTTACGAACGTGGTGGTGGTACTGACGTCGAACATTGGCGCCGAGTTTTTGCTTCCATCTCCAGAGAACACATCGCCGTTGTCGTTGAATGGCACGG
GCTTGCAAAGTCCAAAGAAGAAGCCGCGGTTGATTGACGAGCCCAGTCGCGCCCAATTTGAAGTGCAGAAGCAGTTGGTGCTAGGCACGTTGCAGCGCAC
GATCCGCCCGGAACTGCTGAACCGTCTGGACGACGTGGTGGTGTTTGAGCCGTTGGGCAAGGCGCAGTTGCGCGAGATTGTGAAGCTGCAATTCCGATCG
GCAGAAGACCGTCTCCGCGACAGCCACCAAGTGACGATTTCCATGTCGACGCCCGCCCTGGATGCGATTTTGGCGGCAGCTTACGACCCCCAGTATGGCG
CTCGACCTCTGAAGCG