Description :
From Genome Similarity Track
Location :
Scaffold_1457:2365- 6128
Transcript NameFunction/comments
Phypl_g13457hypothetical protein

Sequence
3763 bases(100 bases per row)
CCCCTTGGTTAAACTCATACAGGAGGGCACCGCAGCTCAACTGCGTGACTGATAACCACTCAGGATCATCATATCCTTTTCGCTTGACGAGATATTCACG
AAGACGGCAAGAAGTCCAGGTGCGTTTAGTCCATCGCAGGTCCAAAATTTTCTCCACCTCATACTCATCGTTCTGGGTGTCGGGCTCCCAACTGTCTTCG
GGTAACAGTGTGGCATCAAAgtcatcatcttcagccACTTCAATTTCCTCAGACGGGCGTTTTGAAAACAGCGCTCGGGGCTTCAGTCGGCTAAGATGCA
CCCATGGATTCATACGATAACCTGTGTCCTTGACCTTCAGCTTGACCCTGAAGTCGTCATGGATCTCGTCAATCCTGAACGGACCGTGCCACATATGGAC
CAACTCTCGGCTCAATCCTGTCTGAACATTGGGTATATGGCATCACCTTCTTTGAAACCAGCCTTGATGCGATCAGACAAGTCGTCCCACTTCTTGGTCT
GAGCCTCTGACCTCATacgcttggccttcttctgtAAGTCTTCAGCGCAGGCCTGAGTGTAGCTGTAGTCTCGCCGCAGTTTTAGGCGCCACTCAAACGC
ACTGTGTTCAGGTACACTGGACGGCTTGGGCCCAAGCATCGCTGAAAGAGTGCCCTGAGCGTCCCAACCGTGCACAAGGTAAAATGGTGTATCCAGTCGA
GTCGCATCAAATGACGTGTTCAGCGCGAACATCAGTCGCTCAGCGTGGTCATCCTAGTCACTCTGGTCAGCCTCCGCGACGTAGGCTCTGATGCTCCGTA
CAACAGTCTGAACAGAGCATTCCTGTTGACCGTTCACCTGTGGGCGGTAGGCCAAGGTTGCTCGTTGTCTGCTACCAAGCATCTCTCTGAAACGGGTGAA
AACCTCGCTCATGAATCTTGGGTCTTGGTCGTGGCGCAGCATTGAACTTGCTCCAAAACATCTGAACACGCATTCTTCATAAGCTTCAGCGACATCCCGA
GCCGTTGTTGAGCTCATCGGTTTACATATCACAAAGCCTGAAAACGAGTCCTGAAACAGGAGCAGAAAAGTATTTCCGCGCTCAGACTTTGGCATATGAG
TGACGAAATCCATCGACACAAGCTCAAACGGACGTCGGGGTGCAATGTTACCAAGTGACGGGCCAGGGTTCAGAGGTCGTCCCTTGGCCGACGCGCAATC
GGAACATTCTTTGACGAACACTTCCACATCGGCGTACATACGCGGCCAGTAAAACTCTGAACGCAGCTTTTCATAGGTTCGCGTGATGCCCTGGTGCCCA
CCTTGGTAATCCTCGTGAGCGTAATGCACTATGTCTGGACGCAGATCAGTCGGCACAACCAACTTCAGCTCGGACTCTTTGTCTCGCGGGCGATCTCGAG
TGGCCACACTCAGGCGTTAGAGGACGTTCCGGAAGTCCAAGACGTACTGGTCGGCATACCtggcgatcttcttgacCTGAGCGCGGGTAAATTGGTCCAG
CTCTCCTTTCAGATAGTACTTTATCTTCACCAAGAGTGAATCACCATCTTGGTGCGCTTTAATCCTTCGCCACCGTTCTGCCTGGTATTCCAGCGGTCCC
ATCGCCTCGGCTTGCGGTAACTCCTGTTGCGACCGAGCGCGGGTTACTGCAGCCATGCCTTTAGGTATCTTGGAGACCAATTCTAAATGCAGTCgctctc
cagcatctccaaccTGCCAAGATTCACCCAACGACAGGGTCTTGGACGTCAGATAATCTGCGGTTTGACATGAACCAACCGCAGACTCTTGAACTTGGGT
TTGAGAGCTTCGACCTCAGCGAGTCTGCGTTGAAGGATCGGCTGATGGCAATTGATCAGACCCTGGGCTTGCTGAATCACAATCCTCGAGTCACCAACTG
CAACCAAATCCTCAACTCCTCGCTCAATAGTCATAGCTAGACCTTTTAAGAGCCCATGATACTCAGCGTCATTCACAGTCACGTCATTGAGGATAAATCC
TCGAGCATCAATCACATGCCAGCCAGGCAATTGCCACAGAACACATCCACAATTTTCTTGACGAGTCGAAATCTTGGCCGCACCATCAAAACTCAGCACA
ATACCTTTGTAACCCGATTCAAGCATCTCAATGCTGAACGCAGGTATTTGCTTGACTCGTCCCTTGGCCGGAATCAGTTCTTCAGCGACTGCGTCCAAAT
GCTTGCGAGGCGTGATAGCAGCACTTAGAACTGCGGCCAAACTATCTTCGTCTCGTTGAACTCGACGAAGTTCCAGTGACCACCGGGAATGCTCCAGACC
TCATTTGAGATGTCGACCATCAACTGAATTCGACTTCAACAACCATTTCAAGACATACTATCTCGTGTAGATCATCAGTGGAAATTCCGAACCATAGATC
AGTGGTCGAAACAGTTTCAAGACTCGCTGGATTGCCAAAACCTCCTTCTCAGCAATGTGATATCTCACCTCCGACTCGTTCAGGACACGCCCAGTGAAAC
GCACCGGCTGAATGACTCCTTCGTGTACTTGTACCAACATGGCGCATGCCGCCCAAAGGTTCGCATGCGGTATAATGATAAACTGCTTCGTGCGATCAGG
GTGTCGTAGTAGCGGAGTTGAAACAATATCACGCTTCAGGATCTCAAATGCTTCCTTAGTCCAAATGAGGTCTCGCCCTGAACGCACTTGTTCATCGTTC
AGCTCGTAAAGAACTGCAGCCACCACAGGGAGATCTTCGATGAATTTGTTGTAATAGTTCAGGCTCCCAAGGAATGACTGAACTCCTTTCAGCGTAGATA
GAAACGGCAAGTCTTGAACGGACTTCGCAATCTTAGGCGTAGCTCGAATTCCTTCAGCATTAATCTCATGCGACAGGTACGGGATGATCAACTTGCCAAA
TTCACTTTTCGGGAGACTCACAGAGATATTCCAATACCGGAACCGAAACAGGAGCGCGTTCAAGTCTTCACATAGTCGATCCCAGGTAGGAGCACCATGT
GCGATATCATCAATATGCGAACTGCGTCCAAGCACGGGCCCATCTGCGGGGGAGCATGGATATTTCGCTTCAAAGCTGTCATCTGCTTCGTCAGTATGGG
AAGCTTGGTCGTCTTGTGTTCAGCACCGTGGCCGCATGTGTGTTGAAAACCCTAAACGCAGGTACGCCCAGAGTCCGGCACATCCAAGTCCAAGAATTTC
AAGACATCTTGGTCAACCTGGGCCTCCTCTTGGGGCGGCAGCCGAACGAACCCCACAGGCAGTTGTTGATCACTGCTTGGTATACGAGAGGTGTGTTCCT
GAGTCCGAACGGCATTCGGATCCACTGGAAGTGTCCAAACGGGCAAATAAATGCCGAGATCAGCTTTGCGCGCTTAGTCATGAGCACTCGCCCAGAAGCC
ACTAGCCATATATAGGCTCATGAATCACATAATAGACTCGAAACCAATCAGCAAGTGATCGATCAAGGGCAGTGGATACCGAGAGAGCTTAATGAACTCG
TTCACCACTCTGTAGTCAATACACATACGGATATCCACGCCATTCTTCTTGAGAACGATCACAATCGGCGAAGGCCACGCATATTCTGAGCGCTCGATCA
GGCCTGTTTCCAGGAGTTTCTTGATCAGCTCATATACTTTAACCAGCAAATGCAGGGGAATCTGCCTTGCGCGCTGAGCCACTGGACGCGCATCTCCCGC
GTCCAAGCCGCAAACCAGACCACGAGCAGGGGCTGGAGCCGCGTTTCCATCGCCTAAGAGGAT