Description :
From Genome Similarity Track
Location :
Scaffold_127:2365- 6115
Transcript NameFunction/comments
Phypl_g3729rRNA 2'-O-methyltransferase fibrillarin, putative
Phypl_g3730flagellar radial spoke protein

Sequence
3750 bases(100 bases per row)
GGCTTGCAACGGTTGGCTGGAGCTCCGACATGGACGTGTCCATCCATTCGaggcgcgcagctcctccagtCTCAATTCCGGAAAAGCTAGGGGCCTCTCG
CGTCTCTCTCTTCTCCCTCAAGTtcctcaacagcagcagaaatgTCTGGACGTGGATTCGGTCGTGGTGgcggtcgtggtggtggtcgcgGCTTcggtgg
cggtcgtggcggtggtcgtggcggcggtcgtggcttcggtggcggccgtgacggtggtcgtggcggtggccgcgGCTtcggtggcggccgtggcggtggc
cgtggcgctcctggtggccgtggcggccgcggtggaggccgtggcggtggccgcgGCGGCATGGCTGGCGGCGCCaaggtcgtcgtggagccTCACCGTC
ACGCCGGCATCTTCATTGCTCGCGGCAAGGAGGACGCTCTTGTGACGCTCAACTCGACGCCTGGCAAGTCCGTGtacggcgagaagcgcatcTCGGTGGA
CGTCCCGGCCGCCTCGGGCGAGGGCACCGAGAAGGTCGAGTACCGCGTGTGGAACCCGTTCCGCTCCAAGATTGCCGCTGCCATTCTGGGCGGTGTGGAC
AACATCTGGATCCAGCCcggcgccaaggtgctgtACCTGGGTGGTGCCTCCGGTACGACCGTGTCACACGTGTCCGACATCGTGGGCCCCACCGGCGCCG
TGTACGCCGTCGAGTTCTCCCACCGCGTGGGCCGCGACCTCATCAACATGGCCAAGTCGCGCACCAACGTCGTCCCGATCATCGAGGACGCCCGTCACCC
GCTCAAGTACCGTATGCTCGTGCCCATGGTCGACGTTGTGTTCGCCGATGTCGCGCAGCCCGACCAGGCCCGTATCGTGGCCATCAACGCCTCGCACTTC
TTGAAGAACGGCGGTCACTTCGTGATCTCCATCAAGGCTAGCTGCATTGACTCTACGGCCCCGCCTGAGGCCGTCTTCGCCCGTgaggtcaagaagctgc
agcaggagcagttCAAGCCCGCTGAGCAGCTGACCCTGGAGCCGTACGAGCGTGACCACGCCGTTGTCGTTGGCTCTTACCGTgcgcccaagaaggagaa
gaagtaGATCATCTCGGGAAGAAGCCACATGGTTTACGCTCTCTAACTATGCAATGTGTTTTTCTACATGCTTGCCTTTGTAGGTCTCCGCCTGGAAATG
TGGAACCTACCTCTTCTTTTGGAAGTCTTCACTCAAGATTTCAAGCTGCGCTCTTCCTCAGAGAGTCTTGTGTGCCAAGGTGTATTGTGTGAGCTGAGTG
TATATTGCATGGGAGTGGGGCGATTCCAAAGGGAGGTTTGTTGCAAGACAACCTCCTATTTTCTCGGTGATTAGAAGCATTGCGTCGGGCGGACTGAACA
AAACGGGGCTTACTGTCGTCTTCACCCGCTGAAAAGTGGTCACTGAGGGCGGCAGTGGGTCCTATCCGTGATCGAAAGACGTCATCAAGCCTCCTAGTGG
GGTCAATGAGAGAAAAGAAGGACAAATGGTGCATATTGTTGGTATGCTTGCATGTGTAGCTTAGCTAGTCGAGTGGTGAGGAAGAGTGCAGCGAGAAGAG
GATGGCCGCCACACTAAGGGTGGGGACCTGTTATGTTCGTTCCTTCGTTTCTTGTTCAACTCGCGTCAGCCAGGAGTCTACTAACATGTTGTGAATGCAG
TAGTCATTGCAGTGAATAAATGTGGTTCTGGGTTTCTATTTCTaccttgttcttgttgcATATTTTTGGTGGCATCTCCGTTCTTGCACGCAACTGTTGG
CGCGTTCAGGCAAGCTACAATGCACCGAGTGAGCGACCAGCTTCGAGACCGTCACCCGTATGCGGACCAACCGTTCCAGGAGTCTCATAACCCCAAGGAG
GTAGGCAAGGACTGTTGAAGTTGACTGTGTTGTCcttgctgaagcagctcttgGGTCTCACTGTCTGTGATCGACCGCCTTCACCAGGTGACGCGCGCAT
TCGGCACTAGAGCGATTCCGAAGTATGCCGAGTTACTGGCGATGGAGGATCTCCCCGACGAAGATCGCTGCCGTGCGCTTCAGGACTTGAGAGAGCTTCT
GAGTAGCCCGAATTTCAAGTATACGGCAATCATGAAGGAGCTCATGTTTACATGTGCCGATTTGACGCACTCCATCTCAACGGAGGTCCGCGCTGATGCA
GCGCTAGTGGTGGCATCGCTGGTTCTGCTTGAAATGGTACGCAATGCTAACTTTGTTGTTGTTACCTGAATCGCAGAGGAAACAACAAATGAACTCACTG
CTTTGGAACAGGACACGCCGAACGACTTGAGCGATGAAGTTGTCCTGGCCACGGCGACTCGATTGCTgggcgatgaagaagaagatgtaGTTGCTGCCGG
CTGCCGTATCTTTATCAACTTGACCATCTCCAATGAAGGCTGCCTCTTGCTTGCGAATAAGATTGAGGCCATGTCCACGCTGGCAAATATGCTGACAACC
CGGCCGCTGTCCAAGTTACCAACCCGTAttgtcgagctgctcgtggaagTGCTGGCAAACCTCACGCGCATCTACGAAGGCGCTCGTACCTGCGCACAAT
TCCCAGTTCTCGCACCAGTGCTGTCGTTGATAAAAAAGCCACGATTGTGTCGAGCCGaaacgctgctgcactcggcgATGGTGATCACGAACGTAGCTGC
GTACGACCAGGCCAAGCGTGAGGCCATCCAGCTGGATGCTGTGGAACTGTGTCTGAAAGCGCTGTCGAAGGTCCTTCTGGGCCAAGTGCGCTGCGAGCCA
ACAGAAAAGCGAGACGAGCTCACTCGTTGTCTCGTTGCAGCAGTGATGGCGCTGTCAACGTCCGAGGACGCCAAGCCGCGCGTGATTGAATTCGGCATCG
AGCCGCTTGCGCAGTGCCTGACGCACGCTAGTGTCTCCGTGCAGCAGaacgccagcatcgccatcaACTCAGCGTGCGAGCTGCCTCGTGGCGTGGCTCC
ATTCATCCAGAAACTGCTTCACTCGCCAGATCTGCTGGTGGACGTCTTGGGCATCAAGGCCGTGTCCGCTCTGGACAAGAAcgtgagcagcttcgacgac
gaggataCACCCGCCGCAGTGAAGGCCCTCACTGCGATTCAGAAGAAAGACGCGCACGGGACCGCCGACCGTATCGTGCAAACCTTGTCTATGCTCGACA
ACCTTGTCAAGGCACTGCTTGAAAATGAAGTGCCTGCGGAGGCCCAGCAAGGCATCGCCGACCTGCTTCGACGGATGGGCCAGACAGACACGAGTTACCA
GCGGCGCGTAGGCCGATGCATGGTGAAGAACAACGTCCCTGACTCCCTGTTCGCGCAGATTCTAGGGCTGACGCCTACAGAATTCCATGAGCAGCTAgcg
tagctgctgcagctgggcAACAACGCCCAAGTTGAAGTACTCTCAATGACATATGGCTACACATTCGGTATTCATTATGGAGAGTTATATACTGATATAG
GTGATCCAATCGATAACATGCCTacatacaaacaccaagATATCGTGAAAAAAAGTTGTCAGGTGGTTCTGGATGTTCCAACCATATGCAACCTCTTATA
GCGCCGTGAGAACAACCTCATTTTCGTGTTCGTTGAGCCGAGAGAAGGTTAGCATCTCCCTCGACAAGGACGGGATTGCGCATCTGCGTATCCAACCACT
GGATGGTTTAAGCTCTGTCCTCCACTGTGAGGACATCTACCAGTTTTTTT