Description :
From Genome Similarity Track
Location :
Scaffold_452:2365- 4079
Sequence
1714 bases(100 bases per row)
GCTAAGGGCGTTGATTGGGGTCGAACAAATTAACCATATTGTGGCTTAAGGCCCGGAAGTGCTCAATGCACGGCCGGAGGCTTTTATGCAATTTGAAGCC
ACGCTTATCGGGCAGGTCCATGACCATGTGGCATCGGCTATGCCGACTCGCTACATTCCTATGCCCGATGAGGAGCCTAAGGCTCGCCGACTCGTTCTGA
GCGTAAAGACCATCGACAAGAAATAGGAGGAAACCTCCTTCTCTGGATTCGAGATGTCGAAATGGCGATGAGCGCCGCTATGCTGCGAACGGAGCAGCAG
AAAGTTGGTCTTGCCATATCAAAACTTGGCGGCAGAGCCTCAGAATGGGCTCTGACATGTGATGCGTCTGTAGACGTCACGTTTCCCATGTGTGACTTGC
TTAAGCGACAAATGTCTCACGTGTTCGTACCGCCTAACCAGGCTTATCGAGTGCGTTCACGCTTCTTATCCTCCCGACAAGAGAAGAAGGAATTATCGGA
CTATATCCAGGAGCTGCGAACTCTTCTCGCAGTTGGATTCCCTTCCTGACGAAGTCCGTGTAACCATTTCTATGGAAAGTATCCGTACTGGGGTCGCTCG
GACCGAAGTTTTTCGTGTCCATCCCGCCACCTTTGAGGAGGCTGTGAACATTGCGCTAAACGCTGAGTTTAACTTCAAAGCGGCTCGCTATGGTACGCAA
GAGCATGCCCAATATTCGTTTGATAGGGCTGAGCCCATGGATCTCAGACATGAGGACGATGGAGTAGCTGATCTTCAAGATGTGGAACAGCAACGTAATA
TCCGTAGATGTTACACGTGCGGAAGCACGAGGCATCTCCGCTCTAACTGTCCATTGCGTACCGCGACATAGTCGGTGGATCCGTAATACCTCTCCAAACC
AGAAACCTGGTATGGTGCGATAAAACTTCTAATCCTAGTAGGCGCAGGGCGCCCTACTGGGGAGGAACTGGGCTTTGTAGAGGCTCTAGAAGGTAGAGCT
GAACACGGCTTAGCCCTACACGATCACGTGGACGATACAACGAAACGAAAAAATACAAGTCAGGCTTGTTGGTTGCCTTGGAAACGGTTAAGGGCTTTGA
AAAGCCGTAGTCAGTTTTGATTGACTCTAGGGTTTCGGGCAACTATGTCCGACGCCGTTCCCCTGACGGAAGTCAGCAGTATGCTGAAGCGCTGAAAGTA
CATGAAGGTGATGTCATCACGGTGCGTCTAGCAACTGAGGCCCGTGTCACCGTACATAAAGTTCCGTTGAACTTAGGTGTAAAGTTTGTTGACTTTGACA
GCATTAAACGCTGTCTTGTCCTGGATTTGGAGTCGAGATATGAAATCATTCTCGGTATGGTCTGGCTGGAACGGCCATGAGCCATTGATTGAATGGAGGT
CGTCATCTACGGGAGGAGCCTGATACAGAGGCTAGAGGCCTCAATGAGATCGCGCATGAAATCTCTGATATGGTCAAACGAATGGAGCAGGGGCTAAACT
ACAACGATTTGGAGAGGTTGTATAAAAAGAAAGTGCCATCCCGTGCACTTTCTGGTTGGCTCCGCACGAATGGGCACAACGACGAGCTAGCCACGGCGTT
CGAATACTACAAACACGTCAAGGACGAGGTGAATGATGTAGTCGAAAAGGAAGCTGCTGAGTGGATGAAACGTCTCACCCCTTCGTAGACCAAGTAGTTT
TGACCTGTAGCTAC