Description :
From Genome Similarity Track
Location :
Scaffold_5:2364240- 2371506
Transcript NameFunction/comments
Physo_249162secreted RxLR effector peptide protein, putative
Physo_467515acyltransferase family
Physo_356410conserved unknown protein
Physo_510391Hypothetical protein

Sequence
7266 bases(100 bases per row)
TCCAGGCCATAAACAGCTGCAGGGCGGCGGCGAGCTCTCGCACTTCCTTGGTATTGGCTTCCGACTTTGCGGCAGAAAGCTCGATTGCGAGCTCCTTGTC
CTCGAACTGGTTCCTCAACACTTTAATGGCAAAGAGATTCCCAGAGCTGAGAACGTTGTACCTCTCAAGGTAAGCCACCCAAAGACCGAACTTGGGGCTT
CCAAGCAGATCGTCTAGGGGAGTTCCCAACAACCCCAGTTTCGCGAACAGGTCCTCCTCGTTTTTTTTGCTTTCCCTTTGTATCTCCACCTATCGAACTG
ATAGTTGACCAATTTCCGGGTAAACAACTGCGCGTTGAGTGACTTAGATGCATACCCGGCCGCAAGCAAACTCACAGGAATCTCGAAGTTATAGTGCCTC
AGCAGCGTGCCAAGCACCTTCTCACCCGGGTCCGCATTCAGCATTGCGTAGCTGAACCAAGTATCAAATACCGGGCTGACGATTTCTTCCTGGTCAAGCT
TGAGCAGTGTGAACACCTCGCGCACCAGTCTGTCCTTTTCCAGCCGGTTCATGCGCTGAGCTGCCTCCAAGCCGCTCGCAGTGATTTCAAAGGTTTTATC
TTTCTTCGCCGCCGCTAGCATCTTGGCCAGAGCTCCATCTCCGATGCGAGATGACAACGTTGATGCGATGAACTGGTCCGCAAGCTGGGGGTTCTTCTTG
TTGGCATTGATCACCGCTCTGGCCCATGTTTGGAATTCAGCATTGGCGAGCAGGTTCGACTCGAGTTGGTTCACTTTGTACTTGGTGAAGAGCTTGTCAG
CACTTGATTGTTTTACGGCGTTTGTGATTTGGGTTATCAATCCGGTTGTCCTCACTTCGAGGAGGTTGTTGGCTCCTTTTCTCCTCAGACTCCTGTCCGA
TCGTAGAGAGCGGTCGACCCACGTCTTCGAGGACACCGCCGAAACACTGCCAATAAGTGCCAGCAAAGCAAAAGCTGCCAGCAAGACGGCGAGTTGAAGA
CGCAAACGCTGCTTGGACTTGTGAGCCATTCTGAGATGGAAAGGGCTTTGGGTGCTGAAGGCTAAAAGCGGAGTGAGAGTTCGGGCTCTCAAGGAACAAG
AAAAGCAAGGATAACAAGCGATGAGGAAGGCGTAATCGTATCGTGCCAACAAATAATCAGGCTCGAGACAGCTAATATATTATGAGCCCGTCTCAAGACG
CTTTCGTTATCGATGTGAACCTCACACTGTCTGTCAACCCGCAGTTACTGCATAGTTTTTTGTTGTTGGTCAGTTTATGAATCTGAATATCACCGCAAAA
TTACACGTATCCAGCAACTCGCAGCGCATCGCGCTTCTGCTTGACGAAATTGTACGGTCTGATGGCAACGTATCGTTAAAACTAGAGCCTTTCGTACATG
CATCATAATTTACATGCCTAATGGGCTGAACTGTTGGATCCACTGACCGCTGGGATAAACTGTAATCTTTTTTTTCACTACTGCTGGTCCTCATTTCTTC
TTCAACTTTCCCTCGGGCTCAGTTAGCATTCTCGGTGCTTCTGCACTAAGAAATAGCTACTGTAAAATGCGGAGCAAGACATTTCCAGTGTAGCCAGGTT
CAAATCAGGCTGTCGGCAGCTACCGAACGGCGTTGTAGTCGTCCGAGCTCCCGCTCCGTTCTTGGATTGCAATGAATGCGTTTTGTGGATCCTAACGATT
TTTTTTGACTTGCGATGTAGCGCGTGGATGCATGTCTTCTTGGACGAAGATTGCAGCTCAACTATCAGTAATTACATTCGCACAATAAAATAAAAAGAAA
ACTAGGTCGCATGCATGATATCAAAAGAAAGTCTTAGCACAACATCTAAAAGAGAGATCCTGTAACCACTCTTATGCCCAGAGGTCGTCCGTCAAAACGG
AAGGAACTCATTCCCCAACTTGCCCCGAAGCAATTGTACGATGTCGTTGAGGGAAGGTGCTATACGGACGGAGATCAAGAGCGAGCTCTGTCGAGGTGCT
ACTACGACCCACGAATATGAACTCGACAGCGACAACTCGCCGCACTGCAAGCTGGATCTTATCGATAGCGACACCGCTTTAATCGTCCACGAGGGCACAA
AAGCGACCGATGAATCGGAAACGGACGAGAAATACCGTCGCAAGAGGGAGCCAAGTCTTCCAGTCAAGCTGAAGTTCCTCACGGGTCTGCGAGGTTTAGC
CTGTTTGCTGGTCGTCCACCACCACGCGGGCTACTTACTGGAGGCGACGATCGCTCCAAGCAGCGTCGACACGTTCTTCGTGCTCTCGGCATTCCTCCTG
ACGGCGCTCAACGAGCCCAAAGTCCGCAATTTGGTCAGTCGCAAGGAAGGCGCTCGCAACTGGCTGATTGCACTCGCCCACTACTCAGTCAAGCGGTTCC
TGCGCGTGTACCCGCTGTTCGCGTTGACAGCGTTCGCTCTTACCTGCATGCCGGAAGCCACGCGCACACGCTACTACAACCTGGCCCACTACAACATCAA
ACACTGGAGTGTGTGGGACATTCTAACGTTCAAGAAACGCTGGTACCTCTTCTGGACAACGTCCATCCAGATCACGTACTACTGCTTGATCCCATTCGTC
CTTGTTGGAGTTTGTCTGCTGGGCAAGTTGAAGTGGTTCGTGGTGGGGGTGCTCTACTGTTGGGTATACTACGAAGGCTGGCACACAAATCGAACGGGCC
ACGGGGAATTCCGCCCCCATTTGTCGACGTTTGTGGCGGGATCGCTCGCTGCTCTGGTTTACTCGAAGCTGGACCGATGGATGAAGGAACGTCGCTTTGA
ACCGCTGCTGCAGCACGTCGTTGCCGTTCGAGCGCTCGAGCTGGCCATGGTTAGCACCATAGTCAGCGACGTCTCTCGCGGATACTTGGCCACTACGTTG
ATCGGGCACCTGTTCCCCTGCCAGGACAAGATCGTGCCCTCGGTCAGCATCCCGCTCTCGACTGTGATGGTAATCGAAGTTCTCATGCCCTCGGCCCTCT
CTCGAGCGCTCGAGTGGAACGTGCTGTGCTACACGGGGAAGATCAGCTTCTCCATCTACTTGCTGCACCCGTTCGTCAACTTCCAGCCTTGGATTAAGGA
GCTCGAGCGAATGGATCAGTTCGCAGTGAGACTCGTGCTGGTGTACGCGCTGGCCTCCATCTCGTATTTCTTGGTAGAACGCAACTGCGAACGTCTTGCG
CTCGTCGTAGGCAAGAAATTGGCGAGAAATGCTGGGCCGACGGTAGGATAAGGGACAAATACTGCTACTTGTGCTAACAAAACTCAACGATAAGAATGCA
ACCGCGAATGCCGAAGTGACCGTGACTTAAATTTACGTCCGCCACACCAAAGGTCCGCCCTTTAGTGGTACAGTGTACCGACCCGTTTGCACACAGAAGC
TTTTTTTTCCAGTCTGGAATTTCCCCAGCGTCTGGCAGAGTCAGAGCCTGAGCTGACGTCATGAGCGCGTGGGAGCAGTGGGGCGGCAAGAAGCCGGCGA
GCGGCGGGCTGCAGGGCGCGCAGGAGGCTTTCAGCAGCCTGTTGCGCGCCTCGCCGCTGTCCACGGCGTCCACGGCGTCCACGGCGTCCGCGGACAGCGA
GGCGGGCGCGGGCTTCTCGCTCAAGAAGGCGTGGGACTCGGCGCGGGACCTGACCAAGAGCGCGGTGGCGGCGCCCGCGTCTTCTTCCTCCTCTTCCTCT
GGGGCGGGGAAGGACGCGGCGGACGCGATGGAGAGCGGGCAGATGGACGGGCAGGTGGACGACGCAGCGGTCGCCAAGTGGCCGCTCTGGAGGAAGAACT
CGACCAGCGAGGCGGGGCTGATCCCGAGCATGAGCTGGTACTGTCAGTAGGCCGGCGTTGAGAAGAGGAGTGGAGGTGTGGAGAGAGTACTGACTTGTGT
TATGTGTTGGCTAGGAACACGCGGTTCAAGTACTTTGTGGGACTCGTGATGCTGGGCATGCTGTTCTTTGGCATGGCGTCCATCTTCCTGCCGCTGGTGA
GCTTGGTGCTGTGTTGCTGGAAGGTGGAGAGGGAGATGTTTAGGTGCTCATGGGTGTGTTTCTTTGGTGGTTGGTTTAGATTATGATCCGGCCGTCCAAG
TTCGCGCTGAGCTTCACGCTGGGCAGCATTTGCTGCATGGGAGCGTTCGCCATGCTCAAGGGCCCGGCGGCGTACATTTCGGGGCTGTTGCAGGCCAACA
GGCTGCTGTTGACAAGTGCCTACTTCGTGACGCTCGGTGAGTTGAGATGGAAGCTCTGTTGGTGAGAGAGGAGGCTTTGCTAATGGACTGGTGCTTTTTG
GTGCTGATGGTAGGGTGCACGCTGTATAGCTGTTTGATCCTCGGCAACTACGTGCTCGTGGTGCTGAGCTCTGTGATGCAGCTCACGACGCTGGGATCGT
TTGCGCTGTCGTCTTTTCCTGGAGGCAACTCGAGCTTGAAAGGTGAGGCTGACTCTTGGTTTGACATGTATATTCATTGTGGCGGCTAACTAATGTACAC
TGGACCTTCGTGTCTGCAGCGTTCGGCGCATTGTTCTGGAAATCAGCACGCGGCATGCTCCAAGCGCTCGCTCGTCTCTTTAGGTAAATATATCGGACAA
CTCGTGACGACGGCGTAGGAACCGCAGACAAGGTGTGGCGTGGACACCCGCCGACACAATAGCAGGCTTGACCCCCATTTTGTTTATTAGAACGACGTCT
TCTTGGCTGTTGCTTCGTGAAGGTTTCGGTCATCCCAAGCCTGTTCATCGAAGTCAAGATCGTTAGTCCATTACTAATCCATTAATCCGGTCGAGTTGAG
AAGTACCCACCCACCCGTTCGCTAGTCGGAGCATTCAGCGCTCGCCTCTCGGGCATGTGACTGTCCATGTAGTCAATGCCTTTGGCGAAGAAGACGCAGA
GGAGGCCGTAGCCGGCGCTGCGTGTCGTGGCGTGGCAGTACACAGCAGAGACAGTGAGTCGGGGCGCCATCAATGCAACAACTCACAAACAAACAGACAC
ACACACCTCTCGCGCGTGCTGAGGTTCCGGAAGGCCTTGTACATGTCTGTTGCTGTCAGGTGTGTTGGTGTATCAGGAGCGAATTTCACCACTGGCAGGC
AGGGCTTGGCACCAGTGGGGTGTTTGAGCCACGAGACAAATCGAGGGCAAGACGAAATGATGAACGGAGGGTAGGGACATGTCGTTTGTGCTTTAGCCTT
CACATCATCTGTGCCATCACCGCGAAAGCACGCGGCTGCAAAGCAAGAGCAAGGTGTCAAGTCAATGACATCTTCGCTGGCTACGCGTCGATCTGTACCC
CGAGCTGCAACCACACCGCGCCAGCCAGCATCGTCTACATCTACACGCAGCAGCACCTTTATGTCCTCCGCTCGGAGACACGCGAGCGCCAGCGCTCCAG
GTGACCGACAAGGGAAGACACATGGCGTCACATCTCAAGAGCGAACCAGCGAGCGAGCGCCTTGCAGCTCGCAAACGCTGGCTATCCCGATCTTCCTGTG
GCGCTTTGTGATGACTGGTGTCGCTCTATTGGCGCCTCCGCTTGGCATCTGCCTGGTTGTCCAGGTCGCTCCACGCCTGATGGACAAATTGATATTGGCA
CATGGGGGTCAGCTTGATTTATCTTACCGGCAGGCAGGCAACTTCCAGCCGACACAACGCACTAGAGCGTCGCCCTTGACCTTGGTCGGGTCCGGTTCCG
GCATGTGGTCGTCCATGTACTTGATGCCGAGCCCCAGCGCCACGCACAGCACGGCGTATCCGGCGCTAAATAAAGAAAGTCAATTGAGTTGTGCAGGCCC
AAGTCAGAACGCCAGCACCGCACTGATGAGGCGGTGAGCAACCGCGTCAAATGAGGGGGATTGGACGGACCTCTGCCGGGCCGAGAGGTGCTTGAACGGC
AGGAACATCGGCGGTCGAAGCTGCGTGAGGAGACTTGCGTTGTGATAATGGTCGCAATAGCAAGAATCGAACGTTTTGCGGCTGGGTTCGTAATTTAACG
CGTGATCTCATTGGCTGACGGGGCTTTTTAAATTGATTTTTAGAAGGTTGCATTCGTAATTTATGGAAGATATGACTTCATAATCGACCACTTTGCGGCA
CTCAACGTAAGCCTGCGACCGGATTTATGCATCTGCTGCAAGCGCCCAAAGATGTGGGGTCTCGGACTCGACAGCCCCCGCTTCTGGCGACGATGGAACG
TCCCTCTCGTCCGTATCTCCTTACAAATTCAAGTGAGGCGGCCCCCGCTTCCGGCAATCAGCGACACGCTCCGACTTCTTTTTTTCCCGGCCCCCGACCC
GTTTGCGCACTTGAATCTCAAATCCGCCAAAGTGCAACGCGTTACAGCCGCCCGGCACGACTGACGGAGACGGCACTGCCTGCCTGCCCTGCATCATGAA
TGATGTCGCCGGGGCGCGAGGCGCAATTGCCAACTTGCCTCCATGTGGCCGAACGCTCGGCTCACCGTTGACCCCGTGACGAACTGGGCGCCGGCAGTGG
CAGCGCCGACACCTGCCGGCGAAGTGCCGACAGCCACCCCGCCGGCATACGCCGGCAGCAGCCGCAGCACCAGCCCAAGCAGCGGCGAGGACACGCCGAC
TGCCGGCCAGACGCCGGTGCGCACGCTGCCGGCCAGCAGCAACAGCTCCAACGCCAGCTCGCAGTCCACCATCAACTCCATGTGGCTCAACTGGAAGAGC
CCCACGGCCGTGCTGGACCTGAGCGCGGAGGCCGAGAGCGGCTCGGCGCTCGAGATGCGGCGCCAGAAGAACCGCGAGTCCATGCGCCGCTCGCGCCAGC
GGCAGCGCGACCAGCTGCAGCTGCTGCGCGACGCCGTGGCCGAGCTGGAGCAGCAGTACAACTCGCTGCGCCTGCGCGCGGACGACGCCGAAAAGGCCGA
CAACAGCAGCAGCAACAACAACAACAGCGCGGCCAACACCAAGTACGCGCAGGCCGTGGAGCTGTCCAAGCAGCTCGGCGCCGAGAACCTGTACCTCAAG
GCGTCCATCCAGTACCAGGCGTCCTGGAAGCTCGAGCTGCGCCGCGTCATGGAGACGACCGTGGCGCTGGACGAGTTCACGGCCTCGGCCTCCGCGCCGC
CCTCTCCGTTCCCCTTCAAGCTCGAGTTCATGAACGAGCAGGAGGCCGAGTCGGTCTTCGGCTTCCACCCCTTGACGGAGCGCGACGTGAAGGATGTCAT
CCTGCAGAACACGCGCTCGGTGAGACGCGTGCAGCACCAGCTGTTCGGCGGCAATAACAACAGCCC