Description :
From Genome Similarity Track
Location :
Scaffold_3:236390- 240453
Transcript NameFunction/comments
Physo_496381ankyrin-like protein
Physo_329114phosphoesterase

Sequence
4063 bases(100 bases per row)
GGGCCCGCGCGCGCAGGCCGACTCGATGCTCCAGCGCGCCGAGTAGTCGAGGAAGCTGCTCACCGCGGCGGTCACGTGCTTGAGCGGCGCGAGACGAGGC
TGCGCGCGGCACACGACGCGCGCCGACGAGAGCGGCGGCGGCGCTGCTGCCATTCTTGCTGAGAAGGTGTCGCGGTGCCTTTTGCTAGTCCGACGTGGAT
TCTGAGATCAGAGCTGTCAACTCCGAGGACAGCCTGTCTGCTCTGGCGATGCGTGCACACCGACCAATGGTAAAGGCGGCGATGCGGCGACAGTTATGAG
CTCCGAGGTCCGGGCGTGACATCCCCACAAAAGTGATTGTACGACATACCGCCGCAGTTGTTTGATCGACCAGATGGTCAATGCAGCTGGGAAGTTTTGA
CGACCACAGTAGCTCCGGTACCTCATCATTCGAAATAAAAGGAACACGAAAAAATACAGTGGCGAAATCTACGCTTCGAAAAAATTGCTCGAGCAACCTG
GGAAGCCCTTGGACAACACTTCATGGCGGCCACGAAGCCACCTCGAAGCTGGCAGCGGCATGGAGCGCGTTCTACCGGCAGGAGCAGCCCCACCGCGTGC
ACAACGCACAGTTCCCATCTCAGCAAAATACAGCGTTGGCATATCACCGGGGCTATCCTGTCGTGACTCCGTGACTCCGGACACATTCACGGCTGGTCGA
GCTCGAGTGCGGCGGACTCGCAGACCCACCACGTGGACGCGTCATACTCGCGCGCGCGGTGCAGCTTCACCTTCTCGCACCACTCGTTGAATCGCCAGTC
AGAGGTCGGCACCTCGAACTCGCAGCCGTCGAGCTTGTCCGCGTAGTGGCACAGCAGCCACTGCGCCAGCTCGATGCACGAATGCCGCACGAATGTTGTG
CCCAGGAACGAAAAGTCCTCGAGACGGTTGGCGTGGAGGAACAGCACTACGCCAAAGTGGGCTCGCATAAGAGCTCGGGTCATGGCGATGGCCGTGCAGC
CTTCACGCCGGTTCTGCTGGAGCCACCTCACGACGTGCAGATGACCACTCGCTGCAGCTTCGTTCATTGCGCCGACAGTGCAACCTTCGGATCGGTTGCC
ATGGAGCCACTTCACAACGTGCAAGTGTCCGTTCTTGGCTGCGTTGTCCATCGCTTTGTCGATGCAGCCCTCGGTACGGTTCTCATGCAACCATTTCACT
GTGTCGAGATGGCCCTCCAGAGCCGCCCAATCCATCGCCCACGTCGTACAGCCTTCGGTTCGGTTCGCGTGGAGCCATTTTACAACGTCCAGGTGTCCAT
TGCGAGCAGCCCAGTCCATTGCGGACGTGGTGCATCCCTCGCTGCGGTTCTCATGGAGCCATTTTACGACGTCGAGGTGACCTTCACGTGCAGCACCATC
CATCGCTGACGTCGAGCAGCTCACATCCACGTTCTCGTGCAAGTACTGAACGACATCCAGTCTTCCGGTCGTGGCAACGTCATCCAGCGCCTGGCACGAG
TGCCCAGCCTCGCAATTTTCATGCAACCACTTGACAACATCCAGGTGGCCGCTACGCGCAGCGCAATCCATGGCGATGGTTTTCGTCACTTCGACCCTAT
GCTCGTAGAGCCACTTCACTAGCTCCAAATGGCCATGGTCCGCTGCGGTGATCATCGTCGCAGCGTCACACCCGTCACACCCGTTCTCGTGGAACCACTG
CACTACATCCAGATGCCCATTCTGAGCCGCCTTCCGCATCGCGTCCGCGGTCAAATTCGCTCCGAGCTCATCGTGCAGCCACTTCACAATGTCCAAGTGA
CCATTCCAAGCCGCAGCCTGAAGCGTGAAATACCCCGGACTGCCGATGGAGTGAGCGTGCAGGAACTTGAGAAACGACAGCGCACCGTCTTTCGCTGGTT
GGTCCCAGTTGATCCACGGCATCACCAGCTCACCGTGCTCGAGGATCCACTGACTCGTTTCCCACTGCCGGTTGCTCATGGCGTTGGCCAGCGCACTGCG
CACGCTAACCTTGTGCTCGTCGTGCAGCCACTGCACAATGCTCAAGTATCCAGCTCCAGCCGCCGCATCCATCACCTTCGTCATGCACTCCGCTCTTGGA
ACTGCGTGTGTCCGCAGCCACTCGACCACATTCGCGTGGTTATTCGCCAACGCGCCGCACATCTCCGTGTTGCCCCAATATCCTCTGTCGTGGTGGGCCT
TATAAAGCCATTCCAGTACTGGCAGGTGTCCATTCGCAGCGGCTGCAGCTACTGCCTTGGTCAGGAACTCGTCTGGCAAATAACCCTCCACGAGCCACTG
CAGCGACTCCAGGTCACCTCGAGCCGCAGCCATCTCCGTGGTTTTGTTGAACAGCCAGTGGCGGTAGAAGGGGTTCATGTCGCCGGGGTCTTCTCGTGCC
GCGACGTACTGCATGAATCGGACGCTGTGCGTCCGCGTGTAGGCGTCGGCGATGGTGCAGTCGGCCGAGAAGTCGTCGAGGAAGTCGTTCAAACGCAGCT
CCACGTGCGGCAGCTCCCCGTCCGGCAGGCAGCAGCTGGCCACGACCCGGGCGCTGGTGAGCGTCGGAAGGAGGACTTGCATCTTGCGTCGACTTGGAGG
AGGATCCGCGAATGCGAGCGGCACCAAAGCTGGGACTTGGAGCAGACGGCTGTCAGCTTCAACTTCAGCTCAGTCATCATGAACGAATGGGATTGGCTGA
AATTGGGTTGACACGGCGAAACGATTGGTCGATAATACCACCTGATACCACTTCAAGATGGCGGCGGAAAGATCACTAGGCGTTTGTATGGTGAAGCCAT
TCTCCTGCTATAGACACGAACATGGAAGGTGCTCAAGATCCCGTTGCTGTGTGAGAGAATACTTGCAGCACACTTGGGCCAAGTGACGTGGTTCACCAAC
TTCCAGTTGTAGTTGTCTTCCGCCGGCGGTGGAGGTGGCCGCTCGACTTGTCGAAAGCTTTCGCTGTTTCTGCAGCTGGAGAGCTCGTCGCCGTACATAG
TTTCCAGCAGCCACGGCTGCATTTCGATCGGAAGGCGCAATGTTGTGTTGGCTGTTTGGCCTAACTGCTTACCGTGATATTATATATATCAATACTGGGT
AGACCTCGTCCGTACAAGGATTTCAGCGATGACCTAGCAACTGCAGCACTACGGTAGGTCGGCCTTTGTTGTGAACTCCTACTTAGCTCTGGTGGGCGTG
GCTGTCCACTCAGACGCAGCTCAAAGATGCGTAGAATGTTGCGAGAGGCGTTCACATCGCGGTTCACAGTAATAACGCATCCGCCATTGTTGCGAAGACA
ATGGAGTACACTGTGAATCATACGATTGCGAACAACGCCGTCTCGGCACTCTTGGCGCTGGTACTGGTTCACGAGGTCGCCGGGGTGCGCCCGCCTGCCT
GCAGCCGTGGTGCACCTTGCTGGTGCAGTACTCGGATTCCAGCTCCACTCGAGAGCTCGCGCATGAACCGCTTGGAGGGGCCGCACGCCGCCAAAGTCGG
AGCAGCTCCAGTCCCCAAAGCCGCTGATCCAGATACCCTTCATCATTGCGGGGATCATTCAGAACGACCCGTCGTACTCGGGGTCGAGAATACCCTTGAG
AACAAAGTAGCGATCGCGGCCAGTCCAGTCAGCCCATAAAGGAGTGCAATGTACTACATGGCCCATGAAACTCAGAACCATCTCCAGCTCGACTTCTATC
GGCGCATCAAGCAGTACATTACATTAAATGTATAACATTACATTACATTAAATGTACTGCTTGATGCGCCGATAGAAGTTGAGCTGGAGATGATTCTGAG
TTTCATGGGCCATGCGCTTGGCTGGCACCTGTGCCCAGCCACGATTGATGCCGTCCCCCCGGTTGGGGATCGGGCTCTCACCTCGCCACGCGCTGCAGAT
CGCCACCGAGTCGCGCAATTCGTCAGTCATGGTCGTTCGAGGATGGAGCAGACCCCCCCCCCCCGCTCACTGCCGACAAGCACTGCGGTAGAAGGAACGC
GCCAAGATGGGGATCTCGAAATCTTGCTCGCAGCAACGAACCGCATGGACACCGGCTTAGGCT