Description :
From Genome Similarity Track
Location :
contig_28:236383- 241630
Transcript NameFunction/comments
g6937.t1hypothetical protein
g6938.t1hypothetical protein
g6939.t1XP_002998461.1 T-complex protein 1 subunit epsilon [Phytophthora infestans T30-4

Sequence
5247 bases(100 bases per row)
CAACTTGCAACCAAACGACTACTTGAAGCCTTCAAGTGAGATTGTTTGATGATTATTGTATTGCGGGACGTTCAAGGGTAGTAGAGCTGAATACTAAGCT
TAATACGAAGTACATGGAAAGCAACGAAGGCGCTGGAACTCAGGTACACCTCTCTCCGTTATCTCTCTACACAAGAAACAATGACCAACAAAGGATACTT
TGTTAGCCTTCCGACACTCCAACCATAGCTATCGGTTGGCTGAACTTGTTGCTGGTCGCTTGTTGGGCTCGCTGACGATATAACAACTACTGAGCACACT
TCAATGCTGTCGGACTTGCATGCGAAGGATCCGATGTCGGAGGATGAGCTTGTCAATTCCGACAAAACACCACTCTGTGGAGGAACCTCCGATTATGAGT
AAGTGACCCGGAACTGGTTGCAGATAAAAATCAGGCTGGTTAAATTGGAGCAGAAGAGAATGGCGCAAACACTGTGCATTGTGTTTGTAAGCTCCAAGAA
AACGTTGTTATCAAGGTTGTGATTACAAACAAACTGTATGTCAGAGAGGGCACATCAACAGGATTGACCAAGACAAAGACAGTGCAGGCCAACTAGGACC
AGGACAGTACGGCAGCTATGGATGCCAACGCTGGGACCGAGGTCTTGGGCCGCGCCAATATTGCAATGTCATTCCAGCTTTTACCGCACAAGACTAACCC
TGCAAGCATCACCATAAGCTTCCACGTGACTCGGCTTCGAACCACTAACTGTAAACCATGCAGCTCATCCAGTTTGGTGTTTTCGCCTCGATGTTGGCAA
CGCTTGCGACTGGTTTATCGTTCTCCGAAAACAATGAGACTCAAGTGAACAGGACACTGCGACCGATGAAGAGAGAATCTATGGCGGATCAGACGGAAAT
GCTGGCAAATACCCGTATCTGGCGAGCCTGCGCAGCGGAGGCCCTACGGAAACACATTTTGCGGTGGTGTGCTCGTCGCACCCCAGTACGTCTTGACGGC
GGGCCATTGTTTCGAAGGGGAACTGGATGACATGTATGTCTCTTTTGGAATGCGGCACTCATCGGGAAAGGGCTCTAACAAGGCTGAGCATACCCGTGTC
TCGGAGATTTTCCGCCACCCAAAATTTGACCTCACGTGGCTGACCTACGATGTGGCACTGGTTAAGCTTGAGACTCCGTCGACAAGGAAGCTAGCGTCTC
TGGCTGCGGCTGATGGATCAAACAACCCACCGGGAACCGTGGCCACGGTAGTGGGGTGGGGATTGGTGAACAACGAAACCTACGGGTTGACACTGAAGAC
TGTGGACGTCGAGATCATCGCGAACGAGCAGTGCGACTCGTTGAATAATGCCACCGTGACAAGCGAGTCTATGCTGTGTGCTGGTACTGGAGGTGGCAAG
GACGCGTGCCAAGGAGACTCTGGGGGCCCTCTCATTGCCAACGGTGCCGTTGTGGGAATCGTGAGTGGTGGGCCTACGGCGGAGTGCGGCATTTTACCCG
GATTTTACACCCGCGTTACGAGCGTTTTGGACTACATCAAGGACATCCTGGATGGTGGTTCTACTGGCAATGTCACGGAGTTTTTGACAACGCCTTACAA
TGACAGCACTGGCGCTAGACCCATGCCGACTGACGAGCACTGATAGAAGGACAGCAACAGGAGGAGGGCAGAGAGGGTGCGAGATTGGCGAGACGTCCGT
GTATATAGTTGATATATACAAAGAGTTTTACACCATGACTTTTGTTTGTGAGTAGATCTCTTTTACTTGGTGCCGACAACCGCCGCATTTGGACCAAAAG
TTTTGGCAAGCAGTCCATAGAAAATGAGTTATCGGTGCGGACACACTTGATGCAGAAACTTGTCGACACATACTTTGTTGTTGCTGCACTTTCGACGTGG
GGTACTCAATTTGTCGCTCTCTCTCCAAAATTCTAAAAAAATCTAGCACAATTATTAGCGGTTCTCTTGGCCACTTTGGAGCTTTCAAGATAATCGCAGA
TGCAACACAGCATCTCACGTTACTTACCCCCCCCCCCATTCCCCGATGACGACAAAGGCAGAAATACGTCGGATATTGTTCTTATTTGATGAACTTTCGT
GTGTTTCACAAAGTGCAGAAAAGTATAAATCACTAACGAGGGGGGCTGGCCCTGCTGCCCAGTCCAGACATTGGGAAGGTCTGCCCGTGCACGCCATCAC
TAGTAGTTGGAGCGACGGCGGCGAAGATCGTCGGTAGAGCCCTTCACTCGGGAGGGGACACACTGCCAGCAGTGGATCACGCCGAGGGAGGAACCAGGTA
CATACTGTACGTGGCCGGACGGGTGGCAGGAACAAAACGATCAGGAGCTTGCGGGGCGATCATTGTCAGCTGTAATGACATATCGAGCGGGGCCAACTGG
AGCGGGCACATGTCATACGCCAGCTCGTCACCGACGACCACGGAAGCGGAACACTTAGGGCTCCTCATGGGACTCAAGGCGTGCGAGAAGAAGCGGTACT
GGCCGCTATGGGTGGTGAGCACGAACAAGATGCTGATTGCACAGCATCGGCAACGCAAGCCCCCAAAGGCACGGCATTTAACACAAATCTACTGGAGGAG
TCGGCGCATCGTGGATCGGCTCCGGGAAGTAGAATGGCTACACCACGCCAAAGAAGCCAACCGTATGGCAATGGAGCTAACAAACACAGCGCTCGAAAGC
AGAACGAGCGTACAACAGTACACGGCTGACACGGGCACCGATTCAGGGAAATGGAGGAAAGTACTCCGCCACCTAGATGGAGACATGATACAATGGAAAA
CACACGAGGACAACGCGGCGCAAGCGGACGTCGTGGCCGACAGTCAGTAAGGACACCGGCACGTAACGGGGAAGCGCAAGCTAGGACCTGGAGAAGGCTA
ACTACCGACATAGGGGCGATGGTTAGAACGGACATAGGAAGTCGTTAGCACAACTAAGTGACATCAATGTACCTCACTGAAAAACAAACAAGGTCTGCCC
GTGCAGCTCTCTCAAGTCTAACCATTGATGTCTAAGCATTGCCCAGCAGTATGTACGCACTTCAGCATTGTTGTCATGCCCTTCGGGGGAATAATGTGTT
GGTGAGTATCAGACTGAAAATAGTATGGGATTCGCTTCCATCTCGGCAAAGTCGCTTCCAAGTATTACAGATACTATTGCTTTCGTGAAAATATCTGACC
CAGTTTGTATTATCTTGAAGAAGACAGATTCCTCGTACCAGCTCTCTTGGAGCAAACGAATGCGACTGCGAGGACTTCGGCCGAAGCGATTGACTGTCTC
CGCTGCAGGTCTTGCAGAAGCTGTGGGGGGCAGGGCAACAATGCGGCAGCTCGACGTTGTTTGTACTTGATTTCACTAACGCGACTGCACCAACGTAATT
CTGCTTTACGAGGCGCGCGTCTCTCTTATATCAGAGTTCATTCTCCTGCGAGCCACGACGAAGAGAAGCGCAACATTTGGGGATGCAGAGCGGTCGGCGC
TTGCTCAGGCGTGGGTCGCCGTCGCATCGGGTCACTAAGTGCACGTGACTGCCGAGCAAATCAACGGTCTGTTCTGGGAGTAGGTGGCGGCAGAATGCAC
CTCCAACAGCACAGAAAGAGCTCAGGAGCTGCAACCTCAATGGAAAAACCAGTCTGGTGGCGTATGTGTCGCTCATTAGTCAGCTGTGGGGGCAATCCGT
TCAAAGGACGACGAGGGCTGCCTGGCAGACGCCTCCGAACTGGCCGCCACGAGCTTCCGAGACAACACCAAGCGGGACTTTGGGTACCTCAAGGAGGCGT
TACTGCTCGTCAGCCACAAGATGCGGTGGAGTGTGCTCAAGCCCCAGCTTGTGCAACAGTTTGCCTTGATGATGAATGGTTACTCGTTCGAGGAGTGAAG
AAGAGGAACAAGGTCAACGAGTGAGGCAGAGGCTGGATGGCTTCCTGTCCGTGGAAGAGATCCCATCCAAGTCTTTTGAGTCCGGTTTGAACGCCACCAA
AGACCCATGTGGATGAAGAGACGGGAAAATGGAAATGGCAGTGGTGGAGCGTCGGCTGGGGCTGGATATCATGACGCAGAGCGAGGACGGATTGTCGCTC
GAAGCAAAGAGATACCTACGCTCGCAGCGTCAACTTGTTCTGAAAGACAAGACCCGGGTGAAGCTGCAGTGAGATGCTTGGAGTAGTTGTCATGCTGCGT
TAGTTGTTTTTAAGCACGAAGGATGTACGTAGTGTTTGTTGCCTGATGATGCCAGTTCCTGGCGTCAATTTTCAAGACACCCTGCACAACAAAACGCAAG
ACACGAGACACTGGGCCAGAATGTGGACTATAAACTAAACCTTCCATTTGACCCACCACGCCTGTGCAAGCTGCAGTGTGGCAGCAGTAGAATATAGGCT
TTAATCGGCCTACGCGTACGAGCCTTCAATAATCACATCATCGATCTTGAGGATCATCCGCACGACCTGCGTCGCGAGCTGCAGCTGCTGCTGCTTGCCG
ATCAGCGTCTCGAACACCTGCTGCTCCTTCATGTCGTTCGTGCCGGACGAGTTGCAGTCAATGCCGAGTCGGGGGTTCTTGTCAGCGATCTGCTGCGCGC
GCACGGCCGAAAGCGAGTCGATGGGGCTCAGTCCACTGTTCTCGGCCAGCGCCATCGGGACGTCCTCCAGGGCGTCGGCGAAGGCGCGGATAGCGTACTG
CTCAATGCCCGCCGTGCTGTCGGCGTGTTCACGCACGGCGATACCGCAGGCAATCTCGGCAGCGCCGCCGCCGTACACGATGCGGTTGTTCTTGATCAGG
TTGCGCGTCACGCACATGGCATCGTGCAGCGAGCGCTTCGCCTCCTCCACAATCATCTTGTTGCCGCCGCGCACAAGCACCGTGATCGCGTCCGAGCTAG
CACAGTCCTCAATAACCAGCATGCGCTCCTTCGTGGTACCGAACGCGACCTCGCGCACCGTGCCAGCGCGACCGAGCTTCTCAGGCGTCAGCTCCGCGAA
CCGCGGCACAATACGTCCGCCCGTGGCAATAGCAATGAGCTCCAGCTCGACACCTCCCACCCAACGGACAGCAGGCAGCTCGTTCTGCAGCAGCAAGTGG
TTGGCCTCGTCGTCGAAGCCCCACTGGCAAATGACCAGGTTGGCGCCGCTGTCCTTCACCTGCTTGATCATGGTCTTAAAGTACTCCTGCTCCTGCTCGT
AGAGCTTCTCGTAGGCCTCGACGCTGGTGATGTCCAGTTTGTGCTTG