Description :
From Genome Similarity Track
Location :
Scaffold_1357:2363- 4250
Sequence
1887 bases(100 bases per row)
AGCTGGATAGCTCTGATTGGATGGCATTTGTATATTCGTTCAACCCGCACTCTGACAACTTCCGCATCGCAACAAAGGGGCCATTGTCCGGAGGGGTTCC
TCGTGTCTGAGCTTGTCACTGGCTTGACAGCAACAgtgtacgagctgcagggccTAAGACTCGTGGTGGAAGCACTGGCAGGAACACTGACAGGTTCGTC
AAGTGCGTCGTCCAtgttgcttttgcagctgtGGAGGCTTCTGTGAAGTGACACACCAAATTAGACGCTTATATAGAATACAAAATGCTGTTACACAGGG
TTGCTCGATTTGTTGCGCGTTGATAGAAAGAATCGCCAACGGCAATTTTGAGTAGAACGCACAATACCCTGATTTGTGATAAATCGATGTGAGCCTCCAC
CTTGTAAAGGGCTTCAACTTTTTACAATTCACCGATCTGATCCGCCCAGGCCGCACAACTTAGCTATCCTTCTACTGATTGCGTTAACCCCACCGTGGCT
GATACGAATGCGTCCCGTCGCTGTTCTATATAAAATTGCTTGGAATTTAAGGTCTGTTAGACTCTTCGCGGGAGGGAATATTTGCACTTTCCTGTTTGAA
CTAAGATCGAAATCTTGATGTCATGAAACAAATTTGAACTTGCCCTAGGGCAGCAAATGATAATTCGTTTCCCCTACCCTCTTCTCAGATTCATCAGATT
TTCTCTGTAAAAAGGGTAAAAGAGGTAGTAAATAAGAGTTGTTCCATTTGATTTTAGGGGCTATGCACCAAAAACCGTTGataaaaataataaaatatAT
TTTTGGTGGCAATGTTTTTGGGGTCATCCCATATGCTTTCGAACTCCGTTACCTCGAGCTtagagctgtttcgtgcattgcCGTAAAGACTTTAATGCAC
TTTTGGGCAGACTAAAATACTTTCGTGCAAATATCTAGATTTGATTTTTTGAAAAAATGCGTATGTGATTTAACGCGACTGCTTCAACCTCGAGGCCTTC
GAAGCACATGCAAGATAAAATCAAAGCTAGCACCTAACAGATAAAGTGTAGACGAGGTCTGTGTTCTTTttctcagcagcagtagcggcgCGTTATACGG
TTGAGTGGGAGTgcttgcagcactgccagcacCTCTGCAGGTTCCTCTTCACTGTTCTGATCGAGATCGCCATCTGCGATGATTCCAAACAGGTCGGAGG
CTGAAATTACGTCGGAATCATCCATAGCGTCGTAGTCCGAATTTTCTTGTCCTgtcacgaacagcaagcGTCCGGCGTGGCGCGCGTCCACCGAGCGCGC
GGTTGAAGATAAACTGCTTGCTAAGTACGATAACTATTTTCAAATATTGAAAGAAAAATATGTTAACCCAATTTTTGTGTACATTTATGcaaatgcacga
aacagctcGACTCGAGCTCCATAGATTTTCCCGAAAAGTTATCACCAACGTGATATCAAATGTTTACAAACGCTGCGCTGTCTCTGTTAATACCACCACA
CAATCTGTCCAAAGTCTGGACAGCTGTAATGGTATTTATCCTGGTAGAGTCTACCTACCAGTCTGTATTTAAtactaaaaaaaaacattatCACGTAGTC
TATCGTAGACTACGTCataatgtttttttttttttagtacCATTCTTTTTGCTTGAAATTTAAACTTGACTTCAGTATTGTTGTATAATTTCCAAAAccg
agtacatgtacatgtaccataaGACATTTGAACGATTTGCTGGATTTTTTATGGTTTTGTTCTACGATGTTCGTTGCTGCTCAGTGACTGAGGACAGCAT
CGTAATCTCTATCCAACCGTAATCATCTCCACCAGACTGGCGGCACCAGTTACTGTATCCAATTATCACAACTAAGCTATCACTTTG