Description :
From Genome Similarity Track
Location :
scaffold_151:2363- 3633
Sequence
1270 bases(100 bases per row)
GATTGGGAATGGTCAAAAGATCACCAGGCAATATTTGCCGAAGTAAAGATGAGCTTGAGAGAAGCTTCTGTTCTTGCAGCTACAAACCATATAAAACTTT
TCATGTGGTCTGCAATGCAAATGATTATATCATCGGTTGTGCGTTGATGCAATACGGTGATGAGGGTCGAGAGCGACTTGTTTTGTATCTTTCGAGGCAA
CTTCGAACCGCGGAACGGAACTATCCAGTTCTTGACAAAGAACGtctagcaatgaagtatgtttTGGTTAGGTTTCGTGTGTACTTGCTTGGAGAGGAGC
GCTTTGCAATCTATACAGTTCATGCCTCATTGCGTACGGCAGTCAAGACTCCTCATATATCGCAAAGACTGTTTCGATGgttttccttctttgcggggTA
CAACTTTGCTCTACACTACAAGCTAGGCAAGACAAACAACTTtgccgatgcgttgtcaagacGTCTGGACTATGATCCAAATCCCAGGAGCGAAAACATG
CTcgagtcatgtcgacaatgcgaaGATGTTCAGACGTTCAGAACGGAAACTACGACTACAGTACGCGAAGAAATTGTTGAAGGGTACACGTCAGATGAGG
GCTTGTTGAGATATTTTAACAACCCTTCCGACAATGCACCGCAAGGTCTTCCGTCTTGTACAAGATGGCGTGTTCTCCGTTTTGAAGTACACAAGGGATT
GTTGTACTTTGCGGTTGAACACGGGGATACAGCACGAGATGCTGTCCCAACTGACGAACGTTTTGCGTCATCTTCTCTTATATGAGCTCCATGACAGCCT
TTTGGGTAGCCATCTCGGACGTGAGACTGTCCGGAATTTCTAATAGCCACAGATGTATGAGTGGGTGCGCAATTATTTGAGAACCTGTGAGATTTGCAGG
AGAGTGAAACCATCGGGCTCCACTCAGGCCCCACTTCGTTGGTAGTGACAACCGACAGCTGGAAGTCTGTGCGTATGCTGGacgttgtgtttggcctacc
gAAGGATTCGGCGAGTaccacgggtgtggtggtcatttgagcaagatagctcatcttgcagcagtgctacacaccatcgacggtgtgggtacagcaacgc
tgtttgtcgatcgcgtCTTTGGACAGCATGGACTTTCGGAGTCAATTTGTTTCTGTTAGagccccgcgcttcactgggaaggtttggtctacaatcttca
gcgTGCtaagcaccaagttgaccatGTCAactgcggaccatccgcagaccaatgtcgatggtgtccgtcA