Description :
From Genome Similarity Track
Location :
Scaffold_46:236249- 237898
Sequence
1649 bases(100 bases per row)
TATGTTTCTATTGTGATTTTTGCCATATATGTATTCTTGCAGGTTATGGAACCTGACACGATTATGTGGCCAGCTTCGAGTAGATGGCGTCCGTTGTTCC
CATTAATAGTGGAAAGTGAACAGTTCAAGCAGTTGATCGACGGCTGGATTGAAGAAAAGAAGGACGGACGGTCGTTTCGATTCCAGCTCAGGTGATACGA
CGAATAGAGCGCTCATGGTTGACGATGGTGGACAGTTATGTGACATTGATGTGGCACGTAATAGGAAGAGTTCGCATCGGAACGTGTACATTGAAAACAC
CGTGTTGTGTGCGGTGAATGGTATCGCTGGGTTAGAACAGTTCAAGAGTGAAGACACTTTTCGGAAACTAGCGGAGACCAAGAAGCGGGTTCACGTTCGA
CTTCGGGGCGACAATGACTTTTATTCCCAAGTGCAGAGGGTTAGTAAGAGTAGAGGGTGGGAGGTGGTCGTGAATACACTGACGATGCGAGTGGTGATGC
TTGACTAGCTTCAAGATGCCGAGCAGCCACTTCGTCGCGACAGCTTGAAGACACTTGAAGTGTTCCTTCCTCCTACGATCGAAGGTAGGCTTTATCAATG
GACATTGCTTCGTGAAGATTACTGATCATGACGGTAGAGCGGGATGGCAAGCTCGTTGCATTGAAGACAGGCATGGGAAGCTCTGCTGCTCTCGTGACGT
CACTGATTGCAGCCCTTGTGACGTTCTTTGTACCGACTATAAGCTTTGAGGAACGGCAAAGGGATCTAGAGCTGGTGCATAACCTGGCCCAGTTGAGCCA
CTGCTATGTCCAGCGCAAGGTGCGTGCTGCAGTTTTTTTCTTCATGCAACAAGACGATCGATTGACAAAAATGGTGGGATATAAACAAACAGATCGGAAG
CGGCTTCGACGTCTCAGCAGCATGCTTTGGTTCACAGTTGTATTCCAGATTTCCGGTATCTGTCTTGAACACGTTTACGTCCGAAGACGCAATAGAGCCG
CAGAAGATTGGGCCTTGCATCAGAGACCACGCATTGTGGAACACTTCTAATCGCGTGGTAACCTTTGCTGCTCACCGGGTTGGGATTGCGTATTCTCACG
AAAGTTTGTGCCACAGAAGTCTGCCCGATTGCCTTCTACCTTCCACATCCTGATGGGAGACGTGTCATCCGGATCGGCTACTGTTTCGATGGTCCGGCAA
GTGTTGAAGTGGCAAAAAGATCAACCTAAGCATGCAGCACGAGTGATGGATGCAATTCATCGGCACACCATGGATGTTGAGCGAGGCTTCGCTGAAATTT
GCGATTTGGAGACTAGCAATACAAAACGCGGATGGAAAGAGATGGCTGCTGTAAACCGCGACCAGGTAAGCGCAGTATCATTCCTTGAGACGTCTATGCA
TTGGCTAGCTCACCACCGGATGAATCAATGCTACTCGTATCTATAGTGGGGCATGATTGATACTAAGATCGGGGCCGCGCTCATGAGAGTGAGTGTTGCC
TACGCAGGTCTTCGACAACTAATGCGGTAAGTCGTGCTGGCCTGTCTGTGTGTCCTTGCAGCACGTGTTGTATGATCAACGACTGACAATGTCGCCTGCA
TCGGCATCGAAGTGAAATGGGGACATCTGCTGGGGTCTCGATCGAGCCA