Description :
From Genome Similarity Track
Location :
Scaffold_7:236092- 238929
Transcript NameFunction/comments
Physo_363049Hypothetical protein
Physo_365141Hypothetical protein

Sequence
2837 bases(100 bases per row)
TGGCCAGCGTGCTGTCGGAATCAAGCAGCGTCTTGCACGATGAAGCTTCAGCTACCCCATGTGTGGCGAGGAGGTACGCCATCAGGGGCGTGAACCGAGA
CGCGTAGAGACGCATGCCTGTGGGGCGCTGGAAGTTTTGGTTGGCTGGTTGAGGGTGGGAAGGCAATTGCAAACTGACCATTCTGCTTTGCCAGGTAGCT
TCGCACTCTTCATCAGCCCACGCACAATGCTATCAGTACCGCCCAGGTGCTCCTAAATTAGCATTATGGGCTGTGTCCCAAGCTATTTAGCTGTGGCAAG
GCATAAAGATCAGAACCAGAGGTGTGTCCCAAGCTATTTAGCTGTGGCATGGCATAAAGATCAGAACCAGAGGTGGCACGGGGATATGTAGTCTTTGATC
TCCAATCTTAGATCTCAAATTCATAGGACAGCAGCTGGTCCAACTGGTTTGCGGGCTTTGGCCCGCGGTGTTCGCAGCTCGGTCGCTTTTTTTACTGTAT
CCCAAAACCTGTAGAGGTAGAAAACTTTATTTACTACTACACCTTTGCCCAGCCTACTTCACGTCAGGTTCTTGTCAGTTCCGACAACTTGGATTGGGGA
TTAGACGACTTCGCTTGCACTAAGGAGAGTGGTACCCCTTAATTCGGGTACCTCGCAAAATAAAAGCTGAAAACTTTGGATGCGGATTAGACAACTAAGG
CTGGGCAAAGGTGTAGTAGTAAATAAAGTTTTCTACCTCTACAGGTTTTGGGATACAGTAAAAAAAGCGACCGAGCTGCGAACACCGCGGGCCAAAGCCC
GCAAACCAGTTGGACCAGCTGCTGTCCTATGAATTTGAGATCTAAGATTGGAGATCAAAGACTACATATCCCCGTGCCACCTCTGGTTCTGATCTTTATG
CCATGCCACAGCTAAATAGCTTGGGACACACCTCTGGTTCTGATCTTTATGCCTTGCCACAGCTAAATAGCTTGGGACACAGCCCATAATGCTAATTTAG
GAGCACCTGGGCGGTACTGATAGCATTGTGCGTGGGCTGATGAAGAGTGCGAAGCTACCTGGCAAAGCAGAATGGTCAGTTTGCAATTGCCTTCCCACCC
TCAACCAGCCAACCAAAACTTCCAGCGCCCCACAGGCATGCGTCTCTACGCGTCTCGGTTCACGCCCCTGATGGCGTACCTCCTCGCCACACATGGGGTA
GCTGAAGCTTCATCGTGCAAGACGCTGCTTGATTCCGACAGCACGCTGGCCAAGTCCCTTTCGTCCTGGACCGAAACAGACTTGACTTCAATCGACTTCC
CCACCGTCTTCAAGGAGATCGACACGGCCCTTCCTTGGCTGTCCAAGTGCATCGCCGCCATCGACCCCAAGGCCGTCTACACGTCACTCGCCAGCTCCTC
CGCCGTGAAGAACAGTCTCTCCGTTCTCGAGAACTTTGGCGGAGATCTCAGCACTGCGGACGGTTGGTCAAGCATCTGCACCTTGTTCGATGGCACCATC
AAGCCGGATGTCGAGACCGTTATGAAGGACGTCGTCATGGACGCCCTCAACAGTGTGGACGGCTGCTGCGACGACTTCCTGAGCGAAGTTAAGACGCTGT
TCGGTGGGGACGCGCTCGACGACATGGTGACGAAGCTTCTGGAGCTTGGTCTCAACACCGAATGCAGCGAGAGGACGTACACGAACCTGAAAGGCACGTC
GACCAAAGAAGTCTGCGGCTACTCCATCTACAAGTCCTTCACTTTCATCGAGACGGACGACGATACTGTCTCGCTGTTGAACCTCGCCCAAATCCCCAAC
GACCAGATATGCGACGCGTTCGCCGGCAAGGCCTTCACCAACACCAAGGGCGCCTCGACCACGATCGGCTTCGGCACTAACGGTGCGGACGCCATGGGCA
TCTGCCTCGAGCCCATTGACACGGCGATGCAGTACTTCAAGTCTTGGGGGATCTTCTCGGAGGCCGTCGACGCCGACGGTACGAGCGTGTCGCTCTCCGA
CCTCTTCACCTCGGGCAAGTCGATCCGTGGCAACTTGCTGTTGGATTATGCCGCCTCAGAGTTGGGCCTGCCGCGGATGGGACTACGAGCCACCGAAAAG
GTGCTCTTCGCACTGGGCGCCGTCTCCACCGACGACGGTGACAGTGAGACCTTCCTTCAGGACGGATTCGTGGAGATCCTGGACGGCATGAACTCATACG
CCAAAGCGCTGCTGCTGCACGTCCCGAACAACGGCAGCTGCACCTTCTCGGACCAGTCGATCACGCTGCCGTACGCGGAAGCTGCATCTTCGGTGAGCAC
TGGCACCAGTGCGGCCTCGTCGGTCAAGCTGTCGGGTGTAATGACTGCGAGTGCGGTGCTGGCCTCGTCGCTCCTCGTGAGTGTGCTGCTTTAATCTAGG
CCTTCAGCACCCAGCGGAACAAAAGTAATTCTAAAGAGTGCTCAAATAATCAAGCCGCAAGTATAAATACAAATACAGCGCGATGGGCAGTTCCATAGCT
CTGCACTGCTTTCGAGGTATTCGGATACAAAGCCGTCCGGACTTGAGGCAGTGAAGCATTTGTTACATGTATTTATTTAATACATGCATAAAGGAACTGT
ACAGTAGGCTGGGCAAAGATGTAGTAGTACTATGTAGTAATAGCTGTAGAGGAGCGGTGAGTGAAGAAGTTCTTGAATTTAGCACATGCTCTAATTTTTG
TATTGTGAAGTACCATGCGTCCAATTGCTGGGTCGCTTACGCTGCTCGATCTGCCGTGGCGGATTTACATGAACTCACACTACAGATATTCATGCTGCAT
ACTTGCACAGCTTCAAGCTGCCAGACTGAACTTCAGT