Description :
From Genome Similarity Track
Location :
Scaffold_380:23609- 26129
Transcript NameFunction/comments
Phymu_g9293conserved hypothetical protein

Sequence
2520 bases(100 bases per row)
TTAAAAGCCGAGCGTCGCGCGCTGGTTCCGATACACGAGTTCTGCGTCTGCTGACTCGGGCGACGTTGCGTTGGCAGCGTGAACAGGAGTGCTGCTcatg
gaagaagaagcgactCCGCCGTCAGTTGATCCTCGACCTCCTTGCTGCATGAAATGCGCGTGCGTGAGCTCCAATACCTTCACCCACTTGAGCATCTCCT
CGTGGGTCTTGGCAACGAGACGCGTCTGGTGAGTAGGCGAGCAGATCATAAACTCGTTCGGCTTGCCCACTTCCTTACCATGAAggatctccagcgactt
gtGCTTCAATGGGATCGCTCCACGCGGATCGCGGTCGCCCTCACGCTTGTAGTACCGCAGATACCCATCAGGCTCGATGTTACACCACCGCTCACGAACA
CCACGCAGCGACATATTGCCGAAGGCCCCCTTTTCGTTGGAGTGCGTCGGGTGCTTTCGCAAGATGCCACTCATCGTCGGTAGTGAACCATCTCGGGGGA
TTTGGTTCGAATTGGAGTCGTACGATTGCGTCAGTGAAGCCATAgacgcactgctgctgcttcggtgGCTGAGGTTGGGATCGTATCGTTCAGAGCCTCT
TTGAGCGCTAGCTGAAGGTCTGCCACTATGTGAAGCCCTACCACCGATGGATGCCCTGTTTCCACTTATTGAGCCACGGATACCACCACCAAGCGATGCT
CGGGAGCCTCCCGTAGACCTCCGGATATCCTGCACAGTCGGTGGGCCGACAACGGACGGCCTCAAGTACGGTTCTTTGCTCTTGACCGCCACATTGAGTG
TTCCGTTTGTCAGCGCTTGGAACTGGTCTTGTACCACCTTCATTTCGTCCTTCAACTGCAATCGCCGCTTGCTCAGTTCGCTCTTACGAGCCTCATCTTT
CTCCCCTGCCGCCttcgcaagaagaaccacgGTATCGTGTAACTGCGCCTGGAGTTTTGTCAGCTTGTTTTGAAGCCGAGACGATTCCGACACTCGTTCT
TGCGGGGCTTCATCAATATCAACATGCTCGACTGACGAGTCTGCGTGCTGAAGCTTGACTTGCTTACCTTGATCGACGTCAAAGAACACAttcaactcgt
tctccaTCCGTCGCATTTCGTCAAGGGCTGCCTTCAAATCATCCTTCAGATCCGCACGTCGGAGAGACAGGTTATCAGCCTGTTGTTGATCACCTCCACT
AGATGCCTTCGCGATTCCAGCCACAGTCTCACGCAGGTTTTTCCGCAGCAAGGCGATCTTATTCTCCAAAAAGATCATCTGGGGCGGACGCTCGCCACTA
ATAAAGGCATCCTCGCGCTTAACAGCCTCTGTTGCCACATCCATTTGCTTCTGAAATTGGTGGATTTCTGATTCCACGAACTTCGttcgctcctcctcca
acttgatctcttcttcaagatgTTCGTGCTGTATCTTTATCTTCTCGAGAAGCCGCTCACGCGCATCCTCAGCGCGAGTATCGATAGAGCCTCTGTGCAC
CATAGAGCCCAAAAATGCCGGCGAAAAGAATTTGATCTCCTGCTGTCCCGATGGGTCCAAGTCGAGGTCGCCGTAtacgtccagctcctgttgcAGATCA
TCTAACGTCCCCTCAATCTTGGCACGCGATGCCTGGAGTTCGTCATTTTCGGAAATAATCTCAGTAACCTCTTTTTCGAGCTCCGCTGTTCGCTGGACCA
GCTCCGCCGTCCGAAGCACCTCAGGTGATTCAATTTCCCCAGATATCTGCTTGTCCAACTGCTCGATCATTTCCTTAAGCGAAACAGCCTCTTGGATGAG
ATTTtcacgctccttctccatagattcttggcgttgctgctccgCTTCGACTTGCGACTCCATGACCTCAAACTTCTTCCCCATCTCAAGCATCTTTAGG
CGCATGTGTTGTTTCGTCGCTGCCCACACCTGCATGTGGAGTTCGTGCGATACCATAATCTCAAAGTACTCTGCACGTAACGAGTTCTGCATcactcgag
cagcacgagcctCCTTTACTTCTTCGGTCTCTTCGTGTGGAATCTCTTCCTCAACTCGACCCACAATACCTTTGGAGATATCAGCAAACTTGATGCGGAC
AGGGCGAATCATTCTAGCGAGTAGTTCCAGTACCTCTGAGTACGTGTAGCCAGCCAGAGAAACCCCATTCATCATCGTCACACGCATGTTCACTGCAAGG
CGCTTCTCGGGCTTCACGCTCCAGTTATAAATCTCTGCAGGGCTTGCCATGCCATTTGGTAGCTTGTAAATCTCCGCGATGTGGACCTGAAGATCAGTAA
ATTCCGTACCAGGAATACCCGCAATTTGCTTCAGGTTGAGACCCAGCCGACCTGGCCCGAACGTCACCTCGATTTCGTGAACCCAATTGTAGATAACGCC
AGTTTTCATAGGTGGCCGCAGCCACTGTGTGTGTCCATAAGGGGACACATAGTACGTCTTGCCGTCGTTTGTTTTACTCTGGCGAGTGGACCAGCCCTTC
GGCAGGGCAAGAATCTCCCC