Description :
From Genome Similarity Track
Location :
Scaffold_182:23609- 25677
Transcript NameFunction/comments
Albla_Nc14092870DNA ligase putative

Sequence
2068 bases(100 bases per row)
ACTCAAATCAGATAATTATCGTCATCGCCATCATTTTCTGCTGACACTGTTGCGAGTCCTTGCGCCCGATACAAATCCGCAATCTACACAGAGAGGGCTT
CAATCAATGTGTCTCGGAGATGAAACTCGATGCTCCTTACCTGTGCCGCTGTAGTAGCTTCTGTTGGTTTCTTGTCATCACGTATCCGAATGAACCGTGG
AAATCGCAAGGAGATTCCCTTCTCACGAGCAATCAATCCCATTGCGGCAGTATACTTGGGAGAAATAGATAAATCCGCTCCCAGAATTTCCCACACACAA
CTCGGCTCAAACCAAACATCTGGTTTGATATTGTCGGTGACTACATACTCACGGGGTATCTGTTCCACCTTTTTACTTTGCAGCTGTGCATGCAGTTCTC
TCAGCATCTCGTCTGACAGTCCCGTACCAAGCTTTGTGATGCACTGATACATATCTAAATCAGGATCATAGCAGGCTAGCAAGTAGGCCCCATAAACACC
CGTTCTTTTCCCACGACCATGGAAAGCTCCAATCGGAATCAGATCAGTCGAGTCACCGATACCGTCGAGATAATCTTTTTTCACTTTCAACCACTTGTGA
GAACGATTTGCTGGTTCGTAGGTGGCATCCTCATCAAGAGTTTTCACCATAAGACCTTCACAGTGCTCCTCCGTGGCTTTCTCCAAAAAGGACCGAATAT
GACTGATTGCTTCCTCCAGTGCATCGGAATCAATGTCGTGCCTTGTATCGGTCACATCCATACACTGAACATTTTCGAAACTACCATCCTGAGGCTGGAA
TAAGGCATGCAATTTTTCCCGCCGTTCACGCAGGGATTTCGAGAGTAATGAATCCCCATTTAGGTACAGCAAATCAAAAGCATACACGCACACAGCCACT
TTGATGTCTTCAATGCGAACATTCTGCTCATCGAATAATGCGTTATGTCAGAGCCGAAATGAACACGAGTCATTGCTTACCTTGCGCGAACGCGTACTGA
GAACTTGAAAAGGTAATCGCTTCCGAGTGATACGATCAATTGCGACAATCTCGGCATCCATGATACAATTGTCGAGACCTTCGGACGCTGAGATTGCATT
CAAAAAGTTCATCTTTACATCCGGAAACCGTTCGGTAGTGTTCTCGAAATTTCGCGAAAATATGTGGACTTTTTGCTGAGCATGTGATTCAAGATGTATC
TGTGCCCGCTCTCCATCATACTTGTACTCACAGGTGAATGGTTTTCCTTGAAAACGATCAAAAACCATTGCGTACGTCTTCGTGGGCCGCGCTAACATTG
GTGCCACCGGAGTACCCGGTGTCAGAACACATAGGGAAGCAACCGACTCAAAATCTGTTGGTGTTGAGAGCCATAGAGTTGACCGCTCTTTTTGAACGTG
ATAAAATGCGTCAATGAGCGCATCAAAGCTTGGACGTTCAGCGAAAGCCTTCTTCACGTATGCGAGCGCCATTTGCTGCTTTTGACGATCACTTCGATCT
GATTCCTTCATGAAAGCATACGTCAATGCAGTTACAATCGACTTTTCTGCCAAACCGATCCGTAATTTGCCCTGAAGCCCGCGAATTATAAATTTTGCGG
CTTCGCTTTGATTTTTGTCACCGCCATTTTGACATTTCACGAGTAAGTATTTAATCATTGTGCATTTCTGCTGTTGTGATTGATTGCCAGCTAGCATTGC
TATTTTCTTGAATTGCAAGTGCACGTCACCTACACTAAGAGCCGCACTCTTTTGCCGAGTATTGGATGTGAAACCTTGCAAAACGTTCTGTTTGCATCGA
GCGTTTTGTGCTACTTGACCCAGATCACCTTCTTTCTGGTACAGCTCCTTCACAAATTTGAGACTTGTGCCGGTGGCTTCGCCGATTGCTTTCATTAGAA
TAGCGTCTCCAACGCCAATTTTGATATTTTCATAAGGTGGTGCTAGATCGGTTCCTAAACAAAGATAAATGCAGGGTACCAGATCCTTTGGAGACGTCTC
GACGATCTTGCGATAAAATGATGTGGTTCGATCCTGAATTACGAGCCGAGAAGTATCTTTCTCGATTT