Description :
From Genome Similarity Track
Location :
Scaffold_397:23602- 27552
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_397-abinit-gene-0.30TrkA-C domain protein
Pytir_DAOMBR486maker-pir_contig_397-fgenesh-gene-0.8Endo-1,3;1,4-beta-glucanase
Pytir_DAOMBR486maker-pir_contig_397-snap-gene-0.15Endo-1,3;1,4-beta-glucanase

Sequence
3950 bases(100 bases per row)
TTATCCATCGTGTTGCGCTGCTCATATGAATTTGTTGTGGACAATTTTGAAATTGGTTCCGAGAATCATTTTGAGTGAAGTTGAACTTCGATTATGGCTC
ATTCGTTCGCTTTCGCTAATCGATCCGACAGGATACAGTACCGACGAGCGCCTTCTTCTGGTGAAGTGGGCATTTGTCATGCTAAAATGGACTAACTTCA
GCTTCTATTGTCAGGCAAAGTTCATTAATTACTTGGTGGTAATCGCTCAGTCACATCGCTTCGAGACCTACCGACACTAACTCTATCAACCTACTCTAGC
TATTCGTCTGCATAACGCTGGTGGCGGTCTTGCGTGTGTGCACCGAGGGAAGAACATACACAATGGTCTATAAGCGAGCGCTTTACTGCGGCGCGACGGT
CTGGATGAACTTGACGGCCGCGTGCCATGNNNNNNNNNNTTGTACCAGCATGCGTTAATTGTTTAAATACTGGCGAACTACAATACACTCGGCGTTTACA
TCATTCTCAGTTCTGAATACTTAGGGTCTAAGTTACTGCGGTGCGACGGTTTGGATGAACTTGACGGCCGCGTGCCATGCCTTGGCCACCGCCGCCTTCA
CCTCGGGCTTCTCCAGGTCGCCGCGGTTCACCCAGCCGTGGTTCACATCCGGAAAGTCAATCGCGTTGCTGTGTTTGCTGGTCTCGGCCTTATCCAACAG
GATCTTGATCACGCTGCCGTTCTCGCGCACGAACGCAGGGTCGTCACCCGCTGCGAGGAGCAACTGTGGAACCGTGATGCGCTCCGCAAGCTTCTCGACC
GCACTGTCGCCGTGGAGCATGTTTTCAATTACCCACGATGGGTGGAACGAAATGTTACCCTTGATGACGGGATCCAGTAGTGTGGACTGGCGCGCGCCAA
TCCAACCGCCAAAGCAGTAGCCGTATGACACGATACTCTCGACATGGAACTCACTCTGCAGGAACGCGATGCTGTCCTGGACGGCAGCTCCAAGTACGCT
CTCAAAAGTGTTTTCCTCGAGCCACTCCTGGAAGCGCGACAAATCTCCAGGCGGGAGATACTCTCCGTGGGTCACGTCCACAAGTATGACAGCGTATCCG
CGTTTGGCGAGGTTATCAGCATCGGACTTGGTACGGCCGCTGTCGAGCCCAAACACGTTGGGCATCCCAATGACGCCGACCTTGGAGGTGACGGTGTGGG
TGCCAGATTGAGGACCGGCTATGTAGAGCGTGGTCTTGTTGAATTTCTTGAGGTAGCCGAGAGCGCCTCCATCGCCTTTGAGCTCCGGCAGAGCGGTGGC
AGGGCAGCAGCTCATCTTGGAGTAATGTGTGTGTTCGTGAGTATATTTGCTGCTGGTGGTGGCTGGTGCTGCTCAAATTGAGGAATGAAGGCTGTTGTGG
AGTGCTGCTTCAGCAGTTGGTGATGGTGACATTGAAGGAGATCGCGCAATCTGAGCACCTTGTGGATGCCTTTTTCCTCTGGTATTAGGTTATGCACTCG
AATTTGATATTTACCTTATTAAAGAGGGTTAGTTGTTTTCAGATAGCTGCTTATTGTAAGAGCGACTACTTGAAATTGACGTTGATACACATAATATAAA
GTCATTTGTTTCATAAAACGTTTTATTCGGAGCTCGAGTGACTTTGATTAACATCATTTGGAGGTCTCCTATCAACCACAGAACTTTTCTCTCACCTCGT
CAGTCCAGAACGAAGGAACGGCAGGAGAAACTGAGAGCCACAACTTGGTGGTGGTGATGTGTGTGTGTGCTAGTATCAGCTACTTTGGGGTCATCTCAGA
ATCACAGTATCAGCGAAGGGCAGCGATAATGGCAGCAATTCAATAACTCCATTCCCTGCGCAAAACCCAAGGCTCCTATTAAAGTCTATTCGGCAATGGC
CTAAAATAAGAAAGTATCCGTACTCTCCAGATATTTATCCTGGTGACAACACCTCTAGCGCTAAAGACCACCCGCACTTCCTGCCCAAGCCATCTCTGTA
AACCACTACTTAGCACTGAGGCAAACACTGACGCTGACACCGAAGTCGAAGGCGCTGAAGGGATATGAGTCTTCGCATGTCTCTCGAGCCAGCTCTCATC
ATCCAGAGTTCCAGTTGCAAGACCAAGAGTGCGGGACGAACGTTACTTGTGCCATGAACGAATCGAGAGTGAGCTTTGCGCGTGGAGGTTTGCCAAAGTT
TCACGCTAAAGTGTGATGCGGAGAGAATTGGGGTGTTATCTCTCCAAAGTGGTTGTAGGGTAAAGTAACGTCTAGATAGGCTAAAATTAGTACACCCTAC
CAGATAATGTGCATTTTAGATTATCTCGCTTTAGAGTCAAAATGTTTCTATAAAATGCATGCGAGTTTGCATTGGTTTGTATCAAAAAGCTCGAAATACA
ATCAAGTGAGGTGGGATCCATAAATCGACAATTTTTGAACCCTCCGAGTACTGACCAAGGATTAGGACCGAACCTATTTTGCTCCATCATCCATCGACAC
CACGTCACTCCTGCCTTCATCAACCAACTGCCACGTGATGAGCTGCTGCCCCGTGAACGCCGAGCCTGCGCTCGCCACNNNNNNNNNNNNCGTGGGTGCG
ATCAAGAAGTTCGGGCTCGCGACGTTCTACCAGGCGGGCCCCGCGACCGCGCGCGCCGGACTGCTGGCGTTCACCGACATCTTCGGCCCGGACAGCGGCC
GCTCTAAGCAGGACGCTGACCATTTGGGCCAGCTTGGGTTCGCCGTGCTGCTCGTGGACCTGACGGACGGTGACTGGGTTGGTCTGCACCCGTCGCGCGG
CGGCATGCCCGCGTGGATGCGCCAGTACGACTACGACACATACCTCACGCCGCGCATCAACGACGCGATCGCGTACCTCAAGACCGAGGTGCAAGTGGAG
CACATTGCGAGCTACGGCTATTGTTGGGGCGCTTGGGTCGGCGCACGNNNNNNNNNNNNNNNNNNNNNNNNTCTCTACGCGCGACCAGCCAGTGATCAAG
GGCCACGTGTCGTTCCACCCATCGTGGCGCGTCGAAAACACGCTCCACGGGGACGGCGCGGTTGAGAAGCTCGCGGAGCGCATCAACGTGCCGCAACTGC
TGCTTTCAGCGGGCAACGACCCGGACTTCGTCAAGGCGAACGGCTCGGTGCACAAGATCCTGTCGGCCAACGCGGCGATCGCGGCGCTGAGTGACGTGGT
GGACTTTCCAGACGTAAAACACGGCTGGGTAAACCGCGGTGACCTGGAGAAGCCCGAGGTGAAGGCGGCGGTGGCGAAAGCGTGGCACGCTGCCGTCAAG
TTCTTCCAGACCGTCTGTCCAGTCTAAGCGCGCCGTCCAAGGGAAGCGGGTGAGGATCGAAATCAAGTAAAAAGAGTTCTGTGCGTGTCGGGGGTTTTCG
AGCGACAATAAAGAAACCGTTTTGAGTGTGGATGGCGACTGTAGCAAATGTGAGACTCGTGGGATCTAATGAGGAGCAGCAGCATCGCCGTGAAACGCAC
CTTGGAGTCGAAAGCGGCGCCTGAGGTTATGGATGGAATATGCCGCACTCCATGGGCGTCCGTCCTCGAATTGGACGCGCCATGCGTGTGGTTTACCATT
CACTGCCAAGTAGCACGACAGCTATGACTTTGTCGACATTTTTTCAAAGAACACGTGGCTCACTCTCGTGCCTGGGCGTTTAGATGCGATAGGAACGCAA
ACCAGATCACACAGTCGCTGACCAAGATGCAATTAACAGTACCAAACGCTGTAAGAGCTGTCGAAGAGGTGTTGTTATTCAGGGAAGTTTACATCCTGAC
TCCGCTGGTGTTAACAACCGAGACGTCAATCACGAGAGCAACCTCTTGTCGTCATCTCCCTGAAACGTCGATTACGACTGGAGTCATCCTTGCATCATCT
CACCCCGGCGGAGCAGAGTTGCAGGATCCCAGGCGCGATTGGATCCTCCT