Description :
From Genome Similarity Track
Location :
contig_28:236000- 241246
Transcript NameFunction/comments
g5617.t1serine protease trypsin-like protein
g5618.t1hypothetical protein
g5619.t1T-complex protein 1 subunit epsilon

Sequence
5246 bases(100 bases per row)
AGGTACACCTCTCTCCGTTATCTCTCTACACAAGAAACAATGACCAACAAAGGATACTTTGTTAGCCTTCCGACACTCCAACCATAGCTATCGGTTGGCT
GAACTTGTTGCTGGTCGCTTGTTGGGCTCGCTGACGATATAACAACTACTGAGCACACTTCAATGCTGTCGGACTTGCATGCGAAGGATCCGATGTCGGA
GGATGAGCTTGTCAATTCCGACAAAACACCACTCTGTGGAGGAACCTCCGATTATGAGTAAGTGACCCGGAACTGGTTGCAGATAAAAATCAGGCTGGTT
AGATTGGAGCAGAAGAGAATGGCGCAAACACTGTGCATTGTATTGGTAAGCTCCAAGAAAACGTTGTTATCAAGGTTGATTACAAACAAACTGTATGTCA
GAGAGGGCACATCAACAGGATTGACCAAGACCAAGACAGTGCAACAGGCTGGATGCCAACTAGGACCAGGACAGTACGGCAGCTATGGATGCTAACCCCT
CGATCGAAGGCTTGGGCCGCGCCAATATTGCAATGTCATTCCAGCTTTTACCGCACAAGACTAACCCTGCAAGCCACCATAACTTCCGCGTGACTCGGCT
TCGAACCACTAACTGTAAACCATGCAGCTCATCCAGTTTGGTGTTTTCGCCTCGATGTTGGCAACGCTTGCGACTGGTTTATCGTTCTCCGAAATCGATG
AGACTCAAGTGAACAGGACGCTACGACCGATGAAGAGAGAATCTATGGCGGATCAGACGGAAATGCTGGCAAATACCCGTATCTGGCGAGCCTGCGCAGC
GGAGGCCCTACGGAGACACATTTTGCGGTGGTGTGCTCATCGCACCCCAGTACGTCTTGACGGCGGGCCATTGTTTCGAATGGGAACTGAATGGCATGTA
TGTCTCTTTTGGAATGCGGCACTCATCGGGAAAGGGCTCTAACAAGGCTGAGCATACCCGTGTCTCGGAGATTTTCCGCCACCCAAAATTTGCCCTCACG
TGGCTGACCTACGATGTGGCACTGGTTAAGCTTGAGACTCCGTCGACAAGGAAGCTAGCGTCTCTGGCTGCGGCTGATGGATCAAACAATCCACCGGGAA
CCGTGGCCACGGTAGTGGGGTGGGGATTGGTGAACAACGAAACCTACGGGTTGACACTGAAGACTGTGGACGTCGAGATCATCGCGAACGAGCAGTGCGA
CTCGTTGAATAATGCCACCGTGACAAGCGAGTCTATGCTGTGTGCTGGTACTGGAGGTGGCAAGGACGCGTGCCAAGGAGACTCTGGGGGCCCTCTCATT
GCCAACGGTGCCGTTGTGGGAATCGTGAGTGGTGGGCCTACGGCGGAGTGCGGCATTTTACCCGGATTTTACACCCGCGTTACGAGCGTTTTGGACTACA
TCAAGGACATCCTGGATGGTGGTTCTACTGGCAATGTCACGGAGTTTTTGACAACGCCTTACAATGACAGCACTGGCGCTAGACCCATGCCGACTGACGA
GCACTGATAGAAGGACAGCAACAGGAGGAGGGCAGAGAGGGTGCGAGATTGGCGAGACGTCCGTGTATATAGTTGATATATACAAAGAGTTTTACACCAT
GACTTTTGTTTGTGAGTAGATCTCTTTTACTTGGTGCGGACAACCGCCGCATTTGGACCAAAAGTTTTGGCAAGCAGTCCATAGAAAATGAGTTATCGGT
GCGGACACACTTGATGCAGAAACTTGTCGACACATACTTTGTTGTTGCTGCACTTTCGACGTGGGGTACTCAATTTGTCGCTCTCTCTCCAAAATTCTAA
AAAAATCTAGCACAATTATTAGCGGTTCTCTTGGCCACTTTGGAGCTTTCAAGATAATCGCAGATGCAACACAGCATCTCACGTTACTTACCCCCCCCCC
CATTCCCCGATGACGACAAAGGCAGAAATACGTCGGGTATTGTTCTTATTTGATGAACTTTCGTGTGTTTCACAAAGTGCAGAAAAGTATAAATCACTAA
CGAGGGGGCTGGCCCTGCTGCCCAGTCCAGACATTGGGAAGGTCTGCCCGTGCACGCCATCACTAGTAGTTGGAGCGACGGCGGCGAAGATCGTCGGTAG
AGCCCTTCACTCGGGAGGGGACACACTGCCAGCAGTGGATCACGCCGAGGAGGAACCAGGTACATACTGTACGTGGCCGGACGGGTGGCAGGAACAAAAC
GATCAGGAGCTTGCGGGGCGATCATTGTCAGCTGTAATGACATATCGAGCGGGGCCAACTGGAGCGGGCACATGTCATACGCCAGCTCGTCACCGACGAC
CACGGAAGCGGAACACTTAGGGCTCCTCATGGGACTCAAGGCGTGCGAGAAGAAGCGGTACTGGCCGCTATGGGTGGTGAGCACGAACAAGATGCTGATT
GCACAGCATCGGCAACGCAAGCCCCCAAAGGCACGGCATTTAACACAAATCTACTGGAGGAGTCGGCGCATCGTGGATCGGCTCCGGGAAGTAGAATGGC
TACACCACGCCAAAGAAGCCAACCGTATGGCAATGGAGCTAACAAACACAGCGCTCGAAAGCAGAACGAGCGTACAACAGTACACGGCTGACACGGGCAC
CGATTCAGGGAAATGGAGGAAAGTACTCCGCCACCTAGATGGAGACATGATACAATGGAAAACACACGAGGACAACGCGGCGCAAGCGGACGTCGTGGCC
GACAGTCAGTAAGGACACCGGCACGTAACGGGGAAGCGCAAGCTAGGACCTGGAGAAGGCTAACTACCGACATAGGGGCGATGGTTAGAACGGACATAGG
AAGTCGTTAGCACAACTAAGTGACATCAATGTACCTCACTGAAAAACAAACAAGGTCTGCCCGTGCAGCTCTCTCAAGTCTAACCATTGATGTCTAAGCA
TTGCCCAGCAGTATGTACGCACTTCAGCATTGTGGTCATGCCCTTCGGGAATAATGTGTTAGTGAGTATCAGACTGAAAATAGTATGGGATTCGCTTCCA
TCTCGGCAAAGTCGCTTCCAAGTATTACAGATACTATTGCTTTCGTGAAAATATCTGACCCAGTTTGTATTATCTTGAAGAAGACAGATTCCTCGTACCA
GCTCTCTTGGAGCAAACGAATGCGACTGCGAGGACTTCGGCCGAAGCGATTGACTGTCTCCGCTGCAGGTCTTGCAGAAGCTGTGGGGCCAGGCAACAAT
GCGGCAGCTCGACGTTGTTTGTACTTGATTTCACTAACGCGACTGCACCAACGTAATTCTGCTTTACGAGGCGCGCGTCTCTCTTATATCAGAGTTCATT
CTCCTGCGAGCCACGACGAAGAGAAGCGCAACATTTGGGGATGCAGAGCGGTCGGCGCTTGCTCAGGCGTGGGTCACCAAGTGCACGTGACTGCCGAGCA
AATCAACGGTCTGTTCTGGGAGTAGGTGGCGGCAGAATGCACCTCCAACAGCACGGAAAGAGCTCAGGAGCTGCATCCTCAATGGAAAAACCAGTCTGGT
GGCGTTTGTGTCGCTCATTAGTCAGCTGTGGGGGCAATCCGTTCAAAGGACGACGAGGGCTGCCTGGCAGACGCCTCCGAACTGGCCGCCACGAGCTTCC
GAGACAACACCAAGCGGGACTTTGGGTACCTCAAGGAGGCGTTACTGCTCGTCAGCCACAAGATGCGGTGGAGTGTGCTCAAGCCCCAGCTTGTGCAACA
GTTTGCCTTGATGATGAATGGTTACTCGTTCGAGGAGTGAAGAAGAGGAACAAGATCAACGAGTGAGGCAGAGGCTGGATGGCTTCCTGTCCGTGGAAGA
GATCCCATCCACGTCTTTTGAGTCCGGTTTGAACGCCACCAAAGACCCATGTGGATGAAGAGACGGGAAAATGGAAATGGCAGTGGTGGAGCGTCGGCTG
GGGCTGGATATCATGACGCAGAGCGAGGACGGATTGTCGCTCGAAGCAAAGAGATACCTACGCTCGCAGCGTCAACTTGTTCTGAAAGACAAGACCCGGG
TGAAGCTGCAGTGAGATGCTTGGAGTAGTTGTCATGCTGCGTTAGTTGTTTTTAAGCACGAAGGATGTACGTAGTGTTTGTTGCCTGATGATGCCAGTTC
CTGGCGTCAATTTTCAAGACACCCTGCACAACAAAACGCAAGACACGAGACACTGGGCCAGAATGTGGACTATAAACTAAACCTTCCATTTGACCCACCA
CGCCTGTGCAAGCTGCAGTGTGGCAGCAGTAGAATATAGGCTTTAATCGGCCTACGCGTACGAGCCTTCAATAATCACATCATCGATCTTGAGGATCATC
CGCACGACCTGCGTCGCGAGCTGCAGCTGCTGCTGCTTGCCGATCAGCGTCTCGAACACCTGCTGCTCCTTCATGTCGTTCGTGCCGGACGAGTTGCAGT
CAATGCCGAGTCGGGGGTTCTTGTCAGCGATCTGCTGCGCGCGCACGGCCGAAAGCGAGTCGATGGGGCTCAGTCCACTGTTCTCGGCCAGCGCCATCGG
GACGTCCTCCAGGGCGTCGGCGAAGGCGCGGATAGCGTACTGCTCAATGCCCGCCGTGCTGTCGGCGTGTTCACGCACGGCGATACCGCAGGCAATCTCG
GCAGCGCCGCCGCCGTACACGATGCGGTTGTTCTTGATCAGGTTGCGCGTCACGCACATGGCATCGTGCAGCGAGCGCTTCGCCTCCTCCACAATCATCT
TGTTGCCGCCGCGCACAAGCACCGTGATCGCGTCCGAGCTAGCACAGTCCTCAATAACCAGCATGCGCTCCTTCGTGGTACCGAACGCGACCTCGCGCAC
CGTGCCAGCGCGACCGAGCTTCTCAGGCGTCAGCTCCGCGAACCGCGGCACAATACGTCCGCCCGTGGCAATAGCAATGAGCTCCAGCTCGACACCTCCC
ACCCAACGGACAGCAGGCAGCTCGTTCTGCAGCAGCAAGTGGTTGGCCTCGTCGTCGAAGCCCCACTGGCAAATGACCAGGTTGGCGCCGCTGTCCTTCA
CCTGCTTGATCATGGTCTTAAAGTACTCCTGCTCCTGCTCGTAGAGCTTCTCGTAGGCCTCGACGCTGGTGATGTCCAGTTTGTGCTTGGTCTTGGGCTT
GGGGGGCTCGAAGGGGCACGTCAAGATGCACATCTTGGCGTCCTTGACCAGCTTGGGCATCTGCGGGTGGGAAAAGTCCTTGTCGATGACGATGCCGTTG
ATCAGCGCCGTGTCCTCGAGCGTGCCACCGGCCTTACCCTCCACCT