Description :
From Genome Similarity Track
Location :
Scaffold_1078:236- 8545
Transcript NameFunction/comments
Phyag_g9390dual specificity tyrosine-phosphorylation-regulated kinase, putative
Phyag_g9391methylosome protein 50, putative
Phyag_g9392hypothetical protein PHYSODRAFT_354941
Phyag_g9393mediator of RNA polymerase II transcription subunit, putative

Sequence
8309 bases(100 bases per row)
tcgacgagaagcgacaggcttggcggggtgaagactgtaacactgttTTCAGTCTTGTTCACAGTAATTAGTCTGACTTAGACTATTTATGTGCTAAGAC
TATTTATGAAACCAAAAATAGTCTTGCTGCGAAAACGTTTTCAGAGGGACTCGAACCCTGGGTGTGTCAGACTCGGGATACCgcagcacaaacagctaAG
CCAAATTACAGCGATGATTTGCCTTCGTCAAATGCATTATATAAACTGCCTGTTTAAGTTCTCTTGACTGTAGTTGCTTAATTTGCGTCCACAGGCTAGC
CATCAAAGTGTGCACGATGTTTCTCAATGATATCTTGGAGGTGAGGGTACAGTTGACAAACAGACCACGTACCGTCAATTCCAAGTGACAACCCGCATCG
GATCATTGCTTTGCGAGCGTAGGACATATCATTTTTGTCTTTTCGGAGATTGACATCTTTGACGGCctcggcagcaagttgaaggaagAGCTTTTTTCCT
GGATTTTGAAGCTTTCCCGACCACGAACCATTCTTCCTGACCTTTTTTTTGCCAGCAGTTGCTCTTGATCAACTCCATCTTTTTCTCGTTCCACTTGACT
TCCCAGGCGTCCTTTATCTTTGAAATGACGAAGGAGTCTGCAGGTTGGCATAGGTCCGCAGCATTTGGCGGAAAAAATTGAGGTCGGAGTTGATAGCGTC
AAGCTCAGCGCGGCATTCGTCCGCCTCAAGGTGACCTGAGCAATTGTCGAGGTAGATGGTTTTCTTTCGTCCACGGGGATCGCCGCGCATAGCTCGTCTC
TCTTTTAGATATTCGCGGAACAGTCTTTGAGTCATCCATCCCTTCCTGCTTGAGCGATAGCACACACCAGGAGTTTGGTCTGGAACTCCATGGATAGGAT
AATTCCCCTCAGAGTTCATAAAATCATCGTCGGGGAGTGAATCCTCGCGTTTGATCCTCCTGAGAGCCGAACCACCATCGTCATGACTTCACCTCCAGAC
ACCACATCAGCATACTTCACTATCTTGTCACCGGAAAAACCGAGCGTTTTGCCGTTATCGAAGTCCATAACAAAGTGGTTTTCGTCGATGTTTTCGATCG
CATTTTCATCGAGTGATCCGTCTGCAAAACCACGCTGCAATTCGTCGAGATGGTATGCCACCTCTCTCTCAATGTGCAAAAGCTTTGACtcgctgagctg
cttctttcCTGTTTGAGTTCTGAGGACGATTTGATGCGCCTCCATGAAGACCTGAATCCACCGCGGAGTGATCTTGTCAATGATCAGCGCACCTTTGGCG
TCAACGCTTCGGGAATTGCACCGATCCGTGCTCTCTCTCATGATGTCTTTTACAAGCTGTAACAAAAGCGCCGGCTCAAATTTCACGCCGAGTTTTCACA
GGcggtcgaactcgtcgagaGGCAGAGGATAAAGCCACTCTACCAGAGCGCTTCTCGGTCTTCCACGCCCTCCAATTACTTTAGTGCTgactcgtcgtct
tccaccaCGCCGACGCGCTGACACCGCGACTGCACCGCGTTCGGCTCCCAAAATGCGTTCACGCTTGGCCCACCAATCCAACGCCTTGGCCAATTTGGCC
GCTCGCGTAGAAGAAGTGAAAATCGAGGGAAACGTGTTGACAGCTTGAGCAAACATGCCTTCACTCCCTTTGGCCGCCTCATGCTTTTTCACCCAGCGGA
CGACTTTTCTGCGATGAGCAATGCTACTCACGTTCTGTGTGTGGCGAGATGTATTATGTTCCAGCGGAAGTGCAGGCTCCGAGACATCGAGATCAACACt
cgcgtcgctctcctctcgCGCGGCGACATCAGTAGTTGGGGTCTTGGTCAACGCGGATTGGTCAGTTTGGTCGCACTTCGGACAGGCTATCGGCTGTGCG
AAGCCTTCGTTTCCGGTGGGGCGACCACAGAAGGGGTGCATGTGGCATGAGCAGGTTGGGCAACGATGGACCGGACCCACAGGCTCGCTGCATCCTCTGC
ACGGCGCAGTAGCCTTGGTGGTTGGCATTGTCGGTCGACGTGGAAGCTGGTAAAAATGAAAGTGACATAAAAAACTCTGGTTTCTAGCGCGCAGCTTTCA
AGCCAGGTCCTTCACCCCTACCACCGAAGCGGAGGTATCCTCAGACCAAGGTGGTAGGGTGAAAAGTTGTGGTTCTATAAGTGCTTGCACTTGGTTGGCA
CTTCGAGAaccacaaacagcaaaaccaaaTACTTTGAAAAAAGGTGGACTGGGTGCCTGGAACCCCGTGGTGTAGATTAGCAACTTGCACTCTTACCCGC
TTGGCTCAGGTAAGACTATTTTTGAGTCGGACTATTTATGAATCTGAAAATTTGGGCTGAGCAATAAATAGTCGAAGTCAGCCTATTTACGAACATAGAC
TATTTTTGCGCATAGACTAATTTCTGCTCGTAATAGGCATTGCTAAAACGTTAGTGTTTATTTCAATACGCGGCCACTATTCGGTTATACTCGTTAGCTG
TAACTCTGCGCTAGAGGCAACGCGTTGCAGGCGACTAAGactttgctgcagagccGTCTCGAGCCGTTTGGGCTCACGAATCGTACGAGCTCAAGTACGC
GAAGTCGCGTAACGCGCTGGGTTCAGCTCCACCCAAGTTTTTTCGACGCCAAGAGAAATGTTGAAGGCGGCCAGCTGTGCCGAGTGCGAGGGTGCATACA
AAATCCAACACGATTCGCGTCGGGGAAGCCTCGGAAggcaacgccatcgccagcagGCGACTGGATGCACAACATTCGTGGTCTGTGACACCGGCATCTG
GGCAAATCTTGTGGCCCCTTGGCACTCGGCCCAGTATGGCACCCGTGAGACTCCTCTCGCGTTGAAGAACGTCAATCAAATGGAACCGAAAGAACACTTC
CCGTTTTAGCGCCTGATGGCCCAGCACGAgtttagcagcagcatggagTCGGCGGCCCGATCTTCTCGAGCCCCGCGGCGGGCCCAGCGCCTGCTGCCTG
CGTTGACCCCGGCGCcgcccagctccagctcagcCTTCGCTGCGCCGCTCAAGTTGGAGCAGCCCACAGACAGCagtcggccagcagctcctccgaGTAA
GAAGCCGTCTTCGATTGCTCACGTTTTCTTCAACCGACGGCCTCTGGACTTGATCcgtcgcaccaccagctccctATTAGCCACAGCCAGCAATTCAGCG
CCAACGGCAGTGGCTGCCACGCCGCCGGTCGCTGAAGAACGCAAATTCTGGCAGCCGCATCGTCCTCACGGAGAGAAGAACGGACGACgcagactgcagc
aattgcagcacaAGGACAAGACCAAAGACGAccacaggcagcagcagcagccacagtgGAGACTTCGACTCGGCGGAGAAGTGGAGCATGACGTCGACAG
GAAGAGACACGAGACGGTTGAGATCAGACGGAGACCGGCGCCGTGTCCGCCCTCCGGCAAACAGTTCTTGCTGAGTGCAGAGAACGCTGCAGAGTTGACA
GCGCTGGAACGGGTCGAGATCTTGCAATACGACGAGATCCGATTCGTTTCCACACGGGTAGTTAAACGCAGTCGTCGGAATGGCAGGATCCAGAACGACC
TGCCGGTTCATGGAGATGACGCGCCAATGGAGGCTGAGGAGGATCCCGAAGACTTGCCTATGCAGCTGTACAATGACGGATACGATGATGAACATGGAGA
CTACTTGGTCTTGATGGGGGACCACTTGGCATTCCGATACGAGGTGCTGAGCGCTCTGGGTCAGGGGTCATTCGGCCAGGTTGTCTGCTGTCTGGACCAC
CGTACACGCAAACAGGTCGCTGTCAAGATCATCCGCAACCGGCGGAAGTATCGGGACCAGGCACtcttggaggtggagcttTTAGGACAACTTCAgcgcg
cagcagaagctcgtgACGAGAACCCGCACGTTGTGCGCATGGAGGAGTACTTCCAGTTCCGCGACCACGTGTGCATTGTCTTCGAGGTGTTGGGCACGAA
CTTGTACGATTTTCTCAAAATGCGCTACTTCCACGGTCTACCTATGAGCAGTGTCCGTACAGTAGGCAAGCAGCTAGCACAGTCGCTGGCGTtcctcaag
cagcagcaggttgttCACTGCGACCTCAAGCCAgagaacgtgctgcttgatgcGTCGGCTTTGGCAGGGAACGCGCGGAGCACTGGCATTCTGGACAATG
TAACACTCATCGACTTCGGCAGCAGTTGCCTGGAAAGAACGTCCACGTTCACCTACATCCAGAGTCGATTTTATCGCAGTCCAGAAGTTCTGCTCGGCAA
TGCGTACTCGGGTGCTATCGACATGTGGAGTTTTGCCTGTATCCTGGTCGAGCTGCACACGGGTCACCCCATTTTTGCCGGCGAGAACGAGCGCGAGCAG
TTTGCCTGCATCATGGAGATTCTGGACGTGCCTCCAGTTGATATTGTGAGCAAAAGCAAGCGACGCCTCAATTTCTTCGATGAAGTGGCAAACCCAGCGG
ATGTTGAGGCTGTTGACTACGTCCCGAAGCCGTTTGTGAACTCGCGGGGTCGTCGACGCATACCTGGATTAACCAGCCTCGCTAGCGCTGTGAAGACTGA
AGACCCCGAATTTTTGGCATTTTTGGCAAAGTGCTTCGTCTGGGACCCGAGTCAGCGCCTCACTCCCGAGCAAGCACTTCAGGAACCTTGGATGCgtcac
caccgtcaccaaCAACACGTTGCCAACCCTGTAGAATATGAGCTCTAAGTAATTTGCAGTAACCCATACACGATTAATAAGCGAATTATCACTTGACCAC
GTTATACACCTTGTCACGCGACTGGGATCGGAACTCCTGGGGGTGCTGACACCcccgaagcagcagcaggagaatACGAGGTGTTCGTTTCCGGCGCAGC
ATAGTCTTCAACACTCCACTTGTGCACGCTCTTGTCCCACGATCCAGTTGCAAGCATCGTATCAAACTTCTTGTcacctgaagaaggcgccgtcgtcgga
AGCTGGAACCAACCCAACGCACGCACATAGTCACGGTGCGGCGCAGTTTTCTCCTTGCCAATCAACAGCTCGCGGATGCCACTGCCCGCACTTCGGTCcg
acgagaagctgtcggtggtCACGAACGCCTTGCCATCGTCACCTCCCGTCGCCAACAAGTCGTCGTGATACGGCGAGTACTTGACTACATgcacagcagc
tcgatgtGTCTCGCGTCGAGCCAGCGGCGTGTGTGGCGAGCGTACATCAAAGGTACACACCATTCCATCCTCCAGTCCGACAGAAAACACCGTCGGCTGC
TTCGGATGCCAATCCACCGACAGCGCCGGCAACAGCGTCGacaccgccaacgccgcactttgcggacgacgagcgtCCCACACCTGCACCGTCGTGTCCT
GCGAGGCTGAGCACAGCAGATGCGCGTGCGTCGGATTCATCGCCACACCCCAAATCAAATCCGTGTGgcctgcacagcagcaaaacaacACTGTATCAGC
ATATGTGTGCTCTTCCGCGACTCCAGCCCATTTAACCCACCGTCGAACGTAGCGACCGTCTTGTCCATCGCTCCAATATCCCAAAGCTTCACCCTAAATG
AGATTTCACACATCACCAAAAGTGAGAATGATCCAATACCCCAGCAATTCCGACCTTAAACGTACGTGAGGTCCCAACTGCAGGTAGCGAGTTGGTTCTT
CTCGACAGTTGAGTTGCTGACGCCTGTAACAACGTCGTCGTGTCCCCATCCCGTCGTCTCTGCGTCCTCCTCGGTGCTGCCAATAGGCACAAAGGCGAAC
GCAACATCCGTCGACAATTTCGCGAGCCgcacgtcgccgtcgtcacagcccagcgccagcacgtcgccgtcggcGCCGCCCCAGGCCAGCGCCCCCACGc
ccgtctccagctgcagttCGCACAGCCGCTCGCTCgtggcggcgtccagcagcgccacgccgCCGCTCCAGACGTTCCCTTCGAGCTGCGactgcgccac
cgccagcagcggcagctccggcTCCTCtacgttctcgtcgtcgtccgagaagagcaagttgGGCAGCGAGCACGCGGCCACGGCGTCCACCTGCGCGGCC
GACGAGAAGGCCGGATGCTGCGGCGACGTCGCCATGGTCGATACCGTTTGAAATGATTGGATTGGCTGTAATTTGACGCTTTTGGTGTAGCAGacaccaa
gttgaagtgccttTGAAAGGCAAGGATCACCCTCGTTGGGCGCCTTCGACTGCCTTCATGTGTCCTTGTCTCCCATGGGACCGGCGGCAATTCGCGACAG
TTGGGCGCTTTTTCCTCCCATTCGCTCGTCCCAAGCCtttttgcagcttttggcgCATGCTTAGCGAGCGTGGTCATTTTGCAACTCGCAGCCTAGCTGa
caaccccccccccccccccccccaccGAAGTAGAAGTACTAGTAGCAAGAACTTTCAAGAATGGTGCGAATGCCCACGAGtatggccaagaacaagatcc
CCAAGGAACAGGACGCCAGGGACGCTGCGTTCGaggccgtggacgagatggtgaaCGAGGCCCAGGAGGTACGCAAACGGCACGACCTGGGAGACCGTGG
ACGTCgcacgctcgagcagctccaggaagAAACTCGCAACCTCGGAGACTACGCGAAAGGCAAGATGGAGCACATGAACGACGTGATGCGCGATGCGGCC
GCTACTGCTCGTGACAAAATGCCGAACGCGGTTCCTGGGCCGACGGACGCCATCCGTGACAATGTGATGGATTCGCTCAAGACGGCGAGCGAGAAGCTCA
GCGCTGAGATCACCGACCTTAACGAACGTGTCGAGAGTGTCAAAGCCCGTGTTCAGCAGTCGATGCAAACTGCCGGAATTAATGCCAAAGACACCTGGTA
CCAAACCTCCGAGGCCGCCAAGAATATCGGTGAGCGCGAGTACTGCTTGCCGCTGCCCACGGACCGCATCTGCTCCCGACACGTCGCGTTCGTCGGCATC
CCGCTGCTTGTCTTGTTTCTGTTGCTGATGGTGCGCAGCCATTACCCGAAGAAATGGAACGCCGGTgtgaacaagatgaagaagccgcgCATGATGCTGG
CACGCGAAACTCCGTCCACCGACCAACTCAAGGCGAAAATGGGGAGTGTTGCCGAAAATGTCGAGGACAAGATCCAATACGGCAAGCAACGCGGCAGCGA
ACTGATGGATCAGGCGCGCGGCAAGTACCAGCAGCCGGTGGAGAACAAGACGGATCAGTAACTTGCTtcgatcgtcgtcgtcgagggTCGTCAGCTACAC
AAATGCTCAAGGCTCGGATGAAGGAAGCTGCATCTCTAACGACGACAAACTTACATTGGCCAGCATACGTGTTGCACGTTGTTCGATTTGCTTTGCTAAC
AAACAACAAGTTAAGAAGAGAAACAGTGTCAAATTCGGTTAGTAAGTGTGCAGTTATGCAACTTTCTGCCGCTTGGAGGCTTCTCCACCGGTAGCAACAT
CGTTTTCGCGCTTCACTGCTGCCGGATCctctgcacctgcacctgcacctgcacctgcacctgcacctgcacctgcacctgcacctgccccagcagccgc
cgccgccgcattgttgctctccagcttctccgcaATCTCCGGTGAGTGTTTCTTCATAAGTTGAATCAAAATGGAGTCGACACGCGCCGAAttctcgcgc
tgcttctccatcttctcgtatttttgcttgagcttgagctgcagctctgcaAAACGCACACCACAAGAAATCCTCCGTCAGTATCTTAACGACCTAGTAC
ATCAACATTCGCCCACTTACGCTCTGAGGGGATCACGggctccttcttgtccttggagCTAAAGTCCCACGCGTAGCCCTCCGTGGGGCTGAAGCGGACG
CCCGCCGCCAAGCCGTGGAACGCCTTGTTCACTCTGTAGCTGCatttcttctgcagcgcggTAATAACATCATATACAGCATAAGTATACTGCTACCAGC
TACTACTTCATGCTAAGCAGGTCGTCGTACGAGGCGAGACGTGAGCATGGCGTGGATGTTGGGCGCCTGGTACACAGTACCGTCCAGCACGTAGTAGATG
GCCAATGGCTCCACCTGCGTGCGGCCGCTGCGCCTCTGCTTGCGCACGAtgaaaagctgctgcggcagctgcttggccgcgttgggcagcagctcgtact
cgACGCCGCGCAGGTTCTTGAGCTGGTCGAGCGCCAGCCGCTGCATCTTGAGGCGCTCGTTGTTGCACGACCGGTCGTAGAACGGGGACAGCGCGAAGTA
GTGCAACAC