Description :
From Genome Similarity Track
Location :
Scaffold_1052:236- 6317
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_1052-abinit-gene-0.11Chromosome 1 open reading frame 131
Pytap_DAOMBR444maker-pag1_scaffold_1052-snap-gene-0.4Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_1052-fgenesh-gene-0.2Intraflagellar Transport Protein 140

Sequence
6081 bases(100 bases per row)
TTCTCTTCTTCCTcGCCCCCAATCAGTGGCGTCGACACTGATGCATCATCCTCTTCATCAGCGCGCGGCGTCGGCGCCTCACTCATGGATCCATCCGTGA
GTCCTGGCGGCGAGAGCACTGCCATCGACGGTTGCTCGACGGGTTCTTTCCGTGTGTCGTCTGGCTGCATCGGCGCCACTTCcGCCCCCACACACGCACC
AGATGTAACAACAGAATTCCCCGGCAACGGCGCGAGCTTGGCCATGGCGCATGCACGTGGACACGGCGTCGGGAAGCcCGGGgggAATGCGGGCagCGAG
CGCTGATGCCCAGTCCCGTCAATtcGGAcTTCAAGGGAAATCGAACAACCCGTGATGCATGGTGCTCCCCTGGATTATGCGGATTtGCCGGATGTGGACC
ACACAGACCACACCGGATTGGCTAAAATAGaGTTCGTGATGTGGTTTCCAGTCAATAAaGCACCAAGAAGCTCCTGGAAGCGACGCTACGAGTGCGGATG
GCGTCTGCACTGCCGTTCCCGATCGCCACAGGCAAGAAGAAGCCCGTGCAGGTGTTCGAGTGTCCGCAGGAGTCGTGGAAGTCCAAGAAGAACGCGAGCA
CGAAGGTGTGTGCGCTATGAATGGCAGTAcAGGGAGCGAGGAACTAATGCGACGCGTCGGCGGTGATGATGATGCAGCCGTCGCGCACACAGGACAAGAA
GGGCGATGTGTCGATTGATGAAGAGATCAAGAAGGAGCTAAAtGATGcTtAtGAGAGTGTCAAGCAGTTTGGTGCGTCCGGTTGGCCCGGAATAAaCGGA
ATTGAGATGGGACTGACGAAGCCAtAaCGCAGCCGCCGAGAATCTGAAGGGCAAGGAGAAGAAGCAGCACGACGCCAAGAGAATAGAGCTGCTTGGTGGC
AaGGCTGCAAaGAACCGAAGCACGCCGTATCATATTCTTAGTGCTATTAAGAAGGCGCGcGTTGTGCGGGCGGCGCGAAAGGAAGAGCTGGTGCGTGGAC
TCCTGAGGATGAGCTTCGACAGTTGGAGTCTGACTGTAATGGTGAACACAGAACCGACAAGCtGACGTGGTCAGTGGCAAGCGCAAGCGAGGTAAGGCGT
CCGAGAAGAAGGAGAAGAAGAAGAACATGGACTACGGCGTGCAGGCGACGCTCGGCAACTTCCGCAATGGTGTGCTCAATGTTTCTCGACTCAAATGAGC
CCTCGCCAAACTGTACTGAAGACAATAGAGATCAAATGCTGCGTTCTCTTACACTGCTTTTTTtCATGTGCTTTGCTGCGCTCCCCGTGGCTGCAGGTGC
CTTTATCGCCGTAGTGGGCTGATTGGCGAGGGAATACTACATAAGTATCATCGCATGATCACGAGGTATTCTGCTCTTCTCTCGAGACAGGGTACTCTTG
CGCATTGAGGATATGCAaAcGAGGGCCTCGCAGCTTCTtCGCGTTCGCCaGCCGCTTCAATTCTGCAAACTTGCGAGCATTTGGATGAGCGTTCGCCgaT
AGCACAAGCTGCCTCGGCTGTCGCTCGTTCAGCTTATTAGGAGCATCTCTCAAGGAATGGtGCACGTCTTTTGCGATCTGCTCTCCCTtcGCATCCTCCT
CGTCGTCATTGCTTTCTGGCTCATGGTTCCTCGACTGAAGAGCTAGCATCCTGCTGGTCCTGTTGGTCTGATACGTAAGACGATACTTGGCCAGCAGCTT
CTTTCGGAACTCTTTGGCTTTCTCCTGCTTCTGCTTCTCCTCCCTTTCTTTCTTATACGTCGCCATGTAGTCGGGATACGCCTTGACGGCACGGAGCGCA
CTGCATCTCCGCTTGGCGCTGTGCGCTCGATACAGTCGCTGGATCTTGATCGCTGGCGAATGCTGTAGGCCTTTCAACCACCCTCGTTGCCTCTTGAATt
CGTAAAACACCAGTCGCGTCGTGAGGCCCCGCCATCGCGATTGAATCCGACTCACGAGCTCGTGCTCACGGAGCAGCATTCGCCGTGTGATCTCCATGAT
GTTGTTCTCAACcTTAAACAGCGGCGGCTTCCCACCAGACCGACGAACATACTCGCGGTAGTTCCAGTGCAAGATCTGCAGTTCTCCTGGGTTGTCGTAC
CAGAACACTGGTGGTGTATCTGGTCTCGTCGCGAGCGCGCAGTGcAGTATAGACGGATGCATCGTGCGGATGATTCGGAGACACCGCTCGTATAGAGTTC
GTCGCcGCGCTTGCATGCCCCGCActCTTGTCTGGATCTTCGTGGCGGCGTTGTTGATCCTTCGTTGATATAGCTCTCGCTCCCACaGTTTTCGTCGATA
CGCGAGTCGCCCAAGGAAGCCTCGTGCGATTCGTTGGAGCAGCTGCGTTGCCGGCACGCgCTTGCGTTCGAACTcTTtGATCTTCTGCTGCTCCTCGGCG
ATCTTCTCGTGGAAACTCGTGACCCCAaCACGTAAGTACTTGGTGGTACCGCAGCCCGAACAcACGGGCAGTTGTTCATACAGCGACAAGGGATCGTTCG
GATCATACCGTCGCGGACGCACACGATTGACGTTGATGAATGTCACGCTGTTGCACCGTTGGCAAGTCAGATAAGGCGTcTTCAGATCGTCACGAAGCAA
TGGCACGAGAGCCTCTCGTCGCGCCATTTTGACTGCTTCTTCTTCATCGTCATTCTCATTATCGTCGGAATCCTCACCGTCAGGGTTCCtcTtCTTTtCT
TTTtCTTTTtCTTCTTCaTCTTCTTCTTGTGGTCCGGAGATGGTAGTGGAGGCATATACTTGTCACGTGGTGTCGCCATGACGGCTCTGCTTTGTGAGAC
GCcATTCAAAGCAGTGCAATGCGGGTCGCGAAAGGGCGTGACGCTTCAAACGAGAGTGATTATATAAaCGTGTATTGATGCATTTGTCACGGgCTCACTC
GGCTTCTTCAGCTATGTCTTCCTCCATTTCGTCGTCGATGTCGTCTTCTCGACTGGGGGCCTTtGTGTTCGCACTGTCTCGCTTtCcTCCAGCACTTGCT
CCTCTTGCCCcGCTAGCATACTTCTCTTCGTGTTCCTCGTCTtcACTTCGAGGAgAGTGCTTCATCTCCTGGCGCTTCCaGTCATCATCgCCAGCTCcTC
CACCGACACTGCTCATCTTGCGGCTGACTTCCTGGATGACGCGTGGGTCTACATAGTTCTTGACCACGAGTCCcTtACTTTTCATCGTTTGCATCGCcTC
AAAGGCTTGTTGTAGTTGTCCCTCATGATAGAATGCCTCAGCAATCAACGCGTACGcGTCCCCAATACGGATTGCTGCCTCGATACCCGGCTCCTCAAGT
AGCTTCTGGAGAACGCTCACCATCTCCGCCGCGTTCTGCTCCTGTCGCATCTGCTGTCGAACTGTGATGAATTGCTCCATGAGCAGTGTCTTGGTCTCGA
GTGCCTTCATCAATCGTTCTTTGCTGTCACTCTTGGACTTGGATAACACCTTCGCTGCTTCCTGTAGTGCACCGAGAGCTTTGTCATAGTCTCGGTACTC
TTCCATCTCGGCCTGGGCGCACGCCTGGTAGAAGTTACTCAGCTGGTCGAACGCACGAGCTTTCGtaTAGAACCCGACGATATTCTTCAGCAGGTCTTGG
TCGCGACGCCAGTCGAGTGTCTGGAGATAGTTGGCAGCCAGCACGTAGATGTCGTTGTTGCGCGACACGTTGGCGAAGAACACCACTTTCTCCGTGTCTC
CTGACTTGAGGAGGCACTTCATCGCCTTGACTTTCTCGCCAGCCTGCGTATATTTCTTGGTCGCCAAGTGGTAAGCGCCCTGCTGCTTACAGCACTTCGC
CAACTTCAGAAGCAGCTCGGTTCGCTTCTTCTGCGCTGCCTTGTCTTCACCACCACTCTCTTcTTTtGGTGGGgTCATTTTCTCGGCCATCTCTTCCGTC
ACCTTGACCTTATGCTGCATGCATACATCCAGCGCCTCGTGAATTCGACCAGCCGCGAGTAGCAAGTGTACAGCCTTGGCGTAATGCCcGTTCTCGACGA
AGAAATCAGCGCATTTCTTGAGCATCTGGGGCgACGTGTTGCTTGGCCCGAGTTCATCCGTGAGGTAGTGAAGCTCTTCAAACAaCTGCGCCTGAAAGCA
TAGCTCCAGTGCCTTGGCGATGTTCCcACCTTTGTGATACAATTGCACGGCCTTCTCCTTGTCACCTCGTGATTCTAAGTAGgCCGCACAGTCGAGCATA
TCACtCGGTTTGCTCATCAGcGCAAAGCTCATGAGCTCGGCATCCATATGATGCTCCTTtGCGAGTCGGATTGTGTGGTTGAAGCACTGCCCcAATGCGT
AAAAGTGAATTGCCCTGGggATCTCCCCCATGGCTTCGAACTGCCGTGCCAAATGATACGCTGCTGCACGGTTCCCTTGAcTCGATTCGACGACTTTGGC
CGCGGCCTGGAAGTCCTTCTTGAAGCACAGCACTCGCACGATTGAGAGATCGTCTTTGGCTCGCTCATAGCTTTCGATAGCCAGGTCAAAGTGGCCCTGG
CTcTCCTGGAACTGGGCCCACCAGATGAGCaGgTcTCGGTCTTTCGATGTTGCGATGTACTTCTGAAGCAAGTCTAGTTTTCCTAGTTTGAACAGCATCC
GAGGCACATCCTTATGGTGGgTCCCGGCATCTTCGTATGCTTCgaTGGCTTCTTTGAGATCTCCGAGTGCCTCTAGGTaTTGCGCGTGCTGGTAATGCGT
CGTCTTCAGGTGGATCCGGTCGCGTTTCGCAGAGATATCGACTGCTTTCTGCCAAAACCCACTGGCTTGATAAAGCTTGTTCAACaGgTCGTACCGCCCG
CTTTGACGGTACAAGTCaGCCGCCTCATCGCGCATCCCTAGTTGGATCGCAACCATTGCGATCGGCACCTCGATCTGCGGTTCCTtCTTGGCTTCCTGCA
CGGCCGCAGCTCCACGTGCATGCCCCATATTGCCCAAACAGACCTCCGCGACGTCCAATCGCTTGGTTTTGACACACATGTGGGCCATGTTCTCCCACAC
AGACGGGTTATTGATCAGCTTAACGGATCGGTACGCTTCGTCCATATTGCCGATTGTCATGTAGTAGCAAAAGTCGATCAGTGCTTGGCGCGCGACATCG
TTCACCTTGTCCAGACCGaCAAAATCCTGCATGATCTTTGTTCGCAAGTACGATACAACGTCGGTACCCGAGGCTTGGGCGGCGATCGCAGCCGCAGTCG
TCGTCTCTCCTGGTCCTTTTCCAACCACATATGTGCGAGCTACTTGAGCTGCTGAGCCATCGCTACCTTTTTCCGCCTGTGCTACGAGGTAGATGCGAGG
CACTTGGATGCCCAGTAGTGCACTGAACTTGATATCCAGGTCAAACGAGTTTTGCATGAGGATCCCGTGATCGTTCGAGGCGAAGAAGATCGTGATCTCA
CGCTCTGACAATGTGCTGgaGCGTTGACCAGCGCTTCCTGAAGACGTATCgTCCTCATTACTAaCTCCACCGCCAGATTTTAacGCTGAAAGTGGGTCTG
GCTTCGTCTTGTACACCTCACAGGCTAGTAAGCGAGGctCTTGTGGATCGAAAAAGACTGAAAGAGGATACTTGTTGACTCCAAAGTCGTACTGCTGGAA
GATATTGAGGTCGCTTTGGAAAAGGAaGAGCTTGCCCACAGGCATgcGGATTTTGAGGGCTCCTTCGACGTTGTCGGCGAGTATGCATACCCTTGTACCA
TCGGCATTCACGGCGATTGACCGCATCGACGCCGCACTCGTCTCTCTACCGAAAGCTTCAGTGAAGTTGCCCATACTGCCCGTGGCTTTGGGGTCACGGG
ACTTGAGATCAAACACACGCAGCAGCCCACGATCCGTAGCAACAGCGAGGAACTTGTTCTGCACCGACAGTAGTGCCGGCTTGCCCTCAGCTTCCGTAAA
GGAGActGTCTTCTTCACCAcGCCCTGCATGTTACAGATCTCGACATGGTTGCCCTGTGTGCGGTAGATGGAGTCTCCTCGAAGGACCATGGATGCCGAC
GCGCATTTGAACTGGGCAAGACGCTTGATGGCGTCGGTGGGTCCGCTTGATTCATTGCGCAGTTCAAAcACCTCAGCCTTG