Description :
From Genome Similarity Track
Location :
Scaffold_662:236- 3497
Transcript NameFunction/comments
Hyaar_Emoy2814416hypothetical protein

Sequence
3261 bases(100 bases per row)
TCGGTGGGGGCGCTTTTGAAATACGGCTCGGTGAAGCGCGCGAAAAGGGAGAACACTGGCGAGAAATAGTGAAGGCCGTTCTTCGTACACATGAGAGCCC
GGAATTGGTATGGCGTGCCCCTATGCGTGCAGAATTGTATTCGGCTTTGCAAGGTGAAATTGAAGCTTATGAACGTCGTCGGCGACACATGGTAGAAAAT
AAGATCGTGCAGTCTGGAGAGCGCATACCGCTCTGGCATCACGAAATGTTTCATGTGCGGTACGCTTCTTTGGATAAAGAGCTTGTGGTGAATAATTACT
TTGTGGAATATTTGATTCCTTGTGTGGCTGACTTGACGAACACGTACGAGATTGCTGAGCCCGTAATATTAGCCTGGCATCTTTTCGATCGACTTGCGGT
TGAAGACGATGAGAAATGGACAATTGTGTGTGCTCGTTGTTTGAGGTTGATTGTTCGACGCTACGCAATGTTGTTTCATGGCCAGATCCCAGCGCATTAT
GTGCTCTTGCTATTGCATGATCATATGAACCACTCGCCTGCTTTTGTTCGCGAATGTTTTCTTCTTCTCAGTGCTGCCGTCGTAACCTCACGGAATATTC
GCTCGGCACGCTTGGGTCAACTTGGCACAACAGTGGCGCGCACTGTTGCTGATGTTCTTGCAGATCCTGCACTACTAGCATCGCTGTCAACACCCCTTGA
CTCAGTCGATGAAGTTGACGAGGATACTTCCGTGCGGTTTGTAGATCCAGAAGATGAGGCTGTAGTTGTAGTTAACCAGCGCGATGAGATGTTGCGCGCA
GGAATCTCTGTTCTACTTGTAATTACTAGGTCTGACAAGTCCGTTCTGCAACTGCTTCGCCCCAAGCGTATCTTCCTGTGTCGGCTTATTGCAGTGGAGA
CGTTGGACCACGTGACGATTACCCGCATATTTTTTCTTTTGAAGCAATTGGAGCTTCTGGACAATAATGATGGCTACAGCACTCCTTCCGAAGCAGCAAC
AATATCAAGTTGCACATCGTTAACTTTGTATCCCTTAGTTTCGACAGAACCACGTCTAAGTTCGACAGTTGACGGTAGCTGGAGGTCTCTCACGCTTGTA
TACGCTTTGCTCGCTAGCTGCGATCCAAAGGGGATGGGAATGTGTGTGGCCACAGCTGAATTTTTGAAGAAACATTGTGCAGAACCCCCGACCGTCTGCA
GCGAGGTAGAATTGACGGATACTCAGTCGATGACCTCCTCCAGCGACTTCAATACCATGCTATATAAGGCCGTTGGATTTGGTGGTTGTGGCATGTGGTT
GCTTCTACTTTCTGTAAACTCTAATAACTTTACGAGCATCTTTAACGCATTTCAAGTACGCGCGGCTGATGTAAGCTGGGGTACTGAGCAACGCGAGCGG
CTTCTTCGGTATTTAAAACTCAACTATGTGGATGTTAGTGAAAAGGAGCCAACTCCAAGCTGGAAATCTGTTGTAGATAGCGACGCTAATCGCCGCTACG
AGGTTGACGATATTTTCATCGGCAACATCTTTCTGCGGTCTTATGTTGAAGGCGATGGAGAGTTTTTGGGCAAGTGGACACCCGCAATGTTTAGTGAGTC
AATTTATGCGTTATTCGCGGCACTCGCGGTGGTCGGTTGCACAGAATCTGAGCACGTCGGAACTGAAAGTGTTGGTCTGTCGTCTTCACATCCACAGCAG
TCGCTTCTGAGTCAATGTTCAAGTAGTAAGCGATCATGTGCGGCTGAGCCGTGGGAGGTACGAGTTTTGATTCTAAAGGCTCTAGCTCGACTAGTTCCAT
CCTGTTGCGCTGAAATCAAGATCAAGAGTGAATTTTATGAGTCCTTATTGGCTCCTCTGCGCCGCTCTATGCTCAGTGAAGCAGACCAGCTGTACGGAGT
TTTGTCACTGGAGCTTTTTGTATCAATTTTGTCTACTCCCGAGAAATGTGGCCTCACTATAGGCACGTGTCGACTATTTTTGGAAGAACGAGGTCTACAT
GTGCTCGCTGATTCTCTTGAGAGGATGCGCAGGCCCGCGTATCAGCATGCGCTGCAAACGGTAGCCGTGTTTGGACCTCATCGGCGGAACAACCAAAGTA
ATCAAAACATGGCACGTGTGCTTTTACATCGCTTGACAGAAGTATTGTTGACCCTAGCAAATCAAGAGGAAGCAGGTATTCGAGTTATAAGAAGGAATCC
AGAGGTGGTGACCGCATTGATCGAGCTTGCGTCACGTGAAATTATTATACAGTACGCGAATATTGACGCAGCGAGCGTGTGTCTGAGCTGCCTGTGTGGA
ATGTGTCGTTACATTGGTCTTCGTGCACTAGTGGTCAACGCTGGTGGCATACTTTCGCTTCTAGATATCGTGACTTCCTGCCCGGTCGGATGTTCTGATG
AAGCAGGGATACCAGAGTCGCAGGCTTCAGACACGCGGAGTGAATCAGACACGTCATGTGCTGAGGACGATGAAAAAGAGCGTGCAAACGATAAGCATAC
GCGTGATCGTAAGAAAGTCGACAACCAACGCAGTGAGATCGGCAGCTCAGCAGGGGAGATGCAACGGATTGCGTTACGATTCTTTGGTGCAATACGAAGC
GCTGCATTGGTCTTGCGTGCGTGTCTGGAACCCATAGACGCCTCCGCGCCAGGGTTGGCAACCCAGTTGCTGTATCAGCTGCTAACACCAAGCCTTGTTC
GAGTGCGATTACGCGGTACCTTGTTCTGCTGTTGCTATTCGATAAATGCTAATGGTACCATGATGCTGTTAACTGTAGGTACTTCGTTCGTCCCCCGATC
GATTCATCCTGGCCCTACAAGCTACTGAAGATATTGACACGGCAACGCTCATCTGGACGGTAAATATGAGGCAACGGTTGCAAAAGTGCACCACAAGGGA
GCTCGCAAAGGTACAAGCTGCAGCCGTGACAAAGACTTGGCCACGCTGGAACCCTGACCATTTAATAGCTGCTGACTCGTTCCGGTACCAGTATCCAGAG
CTCTCAAGTGCTCTCGTTCTTCATGACGTGTATCTGGCAAAGTTTGTGGCTACACCTGTGAACGAAATAGATCTGAGAGATATCGACATCGCTTCGTTCT
CTGAGGCGTTGCTGATCTCTATCCAAAGCCATGAAAATGTTTTGCGTATACTGCGAGAGCGAGGATCAAGCGACCATACAAAAGAAGCTGCTGTTCGACT
CATGCGGCAGACTCTGGACAAGCTTGTGAGGTGGCATCCGCAGCATAATCTCGAAGTGGAT