Description :
From Genome Similarity Track
Location :
Scaffold_3601:236- 1395
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_3601-snap-gene-0.1HECT ubiquitin ligase

Sequence
1159 bases(100 bases per row)
GCCTCAGTCGGTGGTGAAGCCGTGCAGCTCGAGCTCGAGCGTGGCGAAGAGCACGCTCTCCATCTTTTCGCGGGACTCGTAGAGCGGGATCTCCAGCTGG
TTGAAGCACGCGTGGCTCGCGATGTACTCGTTCTCCTCTAACTTGATGCCCTTCAGCGTGAACCGACAGAGGCGACCGTCGACGCTGGTCAGCGAACCGA
ACCCTCCCAGTGGGATGCGCGACGACCCGGTCGCAAAGTGCAGTAGTCTGCGACGGTACTCGTTCGGCATCGAGCGCACGAACTCCCAGAACCACTTGAG
CGCCTTCGCCTGGGTCTGCAGACTCGCGCTCACCACCGTGTTCTTCTCCCAGTCGTCCACGTCGATCTCGTCCGAGCCGCAGAGCATGTAGTCGAACTCC
TCCGGGTCGAACAGCATGAGCAGCTCTTGTGGGATCACCTCGTACAGACCCTTGAGGAAACAGTAGAGCTGACTGGACACGCTCTCGAACAGTAGATACC
GGAACTTGCGCTCCAGGTACAAGTCTTTGTTGTCATCGTCTACGTCGATGTTGCGACCGTCTTCAATCAGATCGATCACGACCATCTGGTNNNNNNNNNN
GATTGCCTACTCCAGAGTTGTTCATGATCCACCGCAGACTCTTGTATGCCTCGGGGTCGAAGAACTCCAAGTCGGGAAACGACAGTGGAATCCCGAGAAT
GATCTTCAGAAGTGGCAGCGCCAAGTGGAAGTTGAGCACCTGGCCTTCCGACAGTGCTCGTCCAATCCACCGGCCAGTGCCAAAGTAGTACATGAGGTGG
TCTTCACCGATGTCGTGCGCTGAGTTCGGGTTCAGGTAGAAGATCTGCTCGCCCATGTCGATACACTTGAACACGCCATTCGCTGGCTCGGCGAGCGCCA
GGTTGAGCAGCATGAACCACTCGCGCTGCAGCCCTCCGGCGTCCACACCACGCTCCACAAGGAAGTCGATCCGCATCGCCGACTGAATGCTCTTGCATGG
GATGATGCTCATGGCCTCCATCGAGTCCTGCAGCAACTTATCGCGGCGGATGTTGAACCGCACATACTGCTTCGTGGGGACCACTTGCAGACCCGCCATT
GCCGCGACGAAATACGAGAACTTGGTGGGGAAATCACTTGCAGCGAGTTTGAGTGCCTC