Description :
From Genome Similarity Track
Location :
Scaffold_127:23597- 27680
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_127-fgenesh-gene-0.1HECT E3 ubiquitin ligase
Pytiw_DAOMBR242034fgenesh-piw_contig_127-abinit-gene-0.76Eukaryotic translation initiation factor 4E

Sequence
4083 bases(100 bases per row)
GCGCAAGACGTGCCTCATGTGCGGCACGAGCGTCGCGTTCCTCATGTCGAGCCAGCTCGTGCGACTCAAGAGCTCGGGCGCGCTGCTCGGCACCGACGAG
CCCAACCTGCTCGATGAGGACCAGCGCGCGAGACAGCGCGCGCTCTTCAAGCGCCGCATGAACTCCATGTCGCTGCGCAAGGACCTGTCGCAGCGCCAGC
GCGGCGCGATTCGCCGCCGGCTCTGGGAGCGCAAGCTCGACGGCGACGGCAAGTTCCACTGGGTGCGCCAGAACAGCACGGACAACTTCAACGACACGGC
GCTCTCGGGCAACGCGATCATGCTCTTGGGCCGCGCCAAGGCACCGCAGGTGAGCGGCCCGCTCGAGAGCATGGCGGACTACCACAACCTGCGCTCGCAG
GGCTTTGTGTGGCAGTACGACGATCTCGGCCGGCTCACATGGAAGCAGGCGGAAGACGGTACGGCTTAGTGTTTGTACTGTGGCTATGTATCGTGACCGG
TGAGGAGTCTGACTCTGTGTGGCTATGTGTGTGTGTGGTGTAGTGACGATCGACATGGAGTCGTTTGGTGGCGGCGCAAACAAGGGCGAGAAGATCGACT
TCGAGGGCATTATGGCGATGGACTTTCGCGTGAAGAAGCAGTGGTTCCTCGTGAACCTGTCGCGCATCGCGACGCCCGTGACCAAGGCCGTCTCCAAGCT
CGGTGCGTCTCTCATGGTCCTGTACTGATCTCAGTGATCTATTCAAACGCTAACTCCCACCACATTTAAACCTTCTTGGATAGCTGTGACACGCGAAAAC
ATTGTGGAGGAGTCGCTACGGCGGCTCACAGCGTCGTCCCCCGAGGCGCTGCACACGTACCTCAAGATCACCTTTGCGGGCGAGCCGGGCATTGACGCCG
GCGGCTTGCTGCGCGAGTGGTTCGGCATCGTGTGCAAGGAGCTCTTCAGCGAGAAGATGGGACTGTTCGTGCCCACGAAGGGCGAGGATATGAGCTACTG
GATCAACCCGCTCTCGGGCGAGAAGAACCCCAAGCATTTGCAGTACTTCCGGCTCGCGGGCATCCTGATCGGCAAGGCGTTCTTCGAGGGGCTCGTGCTC
GACGTGCACCTAGCACTGCCGCTGCTCAAGCACGTTCTGGGCATCCCGATTTCGTTCTCGGACCTCGAGTTCCTCGACGAGGACCTGCACCGCAACAGCA
AGTGGCTTAAGACCAACTCCCAGGTGGAGAATCTATGTTTGACGTTCAGTATCATGAAGGAGAATGGCGAGGAGGTGGACCTGAAGGAGGATGGGCGCAA
CGTGGACGTGATGGACGACAACAAGGAAGAGTACCTGCGCCTCGTGCTCGAGTACCGGATGCTCGAGAGCATCTCGGACCAGCTCCAGGAGTTCCTTTCG
GGGCTCTACGACGTTGTGCCCAAGGGTCTGCTCTCGGTCTTTGACTACCAGGAGCTCGAGCTCATGCTCTGCGGCATCCCGACGATCGACACGGCCGATT
GGAAGGCCAACACGCGCATTCGATACTTCGTGAACGACGACGGTGGCCATAACCCGCTGAGCCGCAAGCGTGTCGTGCCGATCTCGGAGGAGGACCAGGA
CGCCGTGCTCGCGTGGTTCTGGATCATCATCGAGAGCTTCACGCCCGAGGAGCGCGCCCGCTTGCTGCAGTTCGCCACGGGCACGAGTCGCGTGCCCGTC
GAGGGCTTCCGGGGCCTCATGAGCTCCAGCGGCATCATTCACCCGTTCACGATCCAGCTTGTGGCCTGCGGCACCGACGCCGCGGGTCTCTTCCCCAAGG
CACACACGTGCTTCAACCGCCTCGACCTACCGCTCTACCGCAGCATGGAGGAGATGGAAACGTATTTAACCATGGTGTCGCAGATGGAGATCATCGGCTT
TGGGCTCGAGTAAAACAACAAAACATAGTGTCCATATTCAAGAGACCACCAAATGAGTGACAAGCATTCGTGGCCAGTCATTTTTGTGGCATAAACAAAT
GAAATGGCTACATAAGGACAATAACCACAACCATATAATAACATCAGCACTCTCTTGTCGTGATTCTCTATTAATTACTGGGCGTTGTCCTGCTTCGCTG
CCGCTGCGGCGGCTTTGAAAGCCCGCACGTCCTTCTGCAGCACGTCCCGCTCGCGCTGCTTGACGCGCATGTTGATGCCGCTCTGCGCCTCCGAGGCCGT
CGCTGACGCTGCTGCCACCGCCGTTGAGGAGCTCAGGAACGCGTCCTTCTGCGCCTCCCAGTCTGCCGTCGCATCGGGCACCTGTGTCTCTACGACCTGT
AACGGCGCAATCGTCCCTGCGCTCTCATTAGCACCACCACTTGCGCTGCTGCTCTGTTTGTTTTTCTCTCTCTCGGCGACCTCGAGCTCGAGCGACCGGA
GGCGGCTGCGCAGGTCGTGGATCATGCCCATGAGCAGCTCGTCCTTGTGCTCGCGCTCGGTCTCGACCTGCAGCTCGTCCTGGATGCTCTGCAGCCGCAG
CGCCTCGTTGTCGCGCTCCATGTCGTTCTTGACCGAGTTGAGGAAGAGCCCGAGCACCGTGCCGGGTGTGAGCGCGAACATGGCGTACAGGAACTTGCGC
TTGGGCGACAGCAGGTTCCTACCAGTGAGCGACATAAGGAGAGATAAGAACACAACCCATCCACGTATGCATTACACAGTGAACGCATGCGCACTTACTC
CATGGCGCCCGGCGGCGCCTCCGAGAAGAGCTGCTTCCACATGCTGCTCGCGCGGTGGAAATTGAAATGGTGAGCTTTTCGTGAGGCGAAAATTCGGCTA
AGTACGAATATGTCCAACCAAGACCTCATCAAGAGAAGGTGGTGAGAATGAATGGGCTCTCCACCTGGGCTTCAGAGTACGTCGAAAGATCTGATAGCTT
CAATAGCGCAATAGGCAGCTTGCACACCCAGTTGTCGTAGTCCGTTCTTCTTCTCTCTCGTGTATTAATCTTCGTTCTCCTCTCACTCTCCTTCTTCTCT
TCTTCCTGTCTGTTTTGTTCGCTCTACAAAGACGCTGCCGGGTCTGTCGCTACCGTCGTCGCTGCTGGACCGTGACGCGCTCTAGTGGTTCTTGTGCACA
AACTCGCCGGCTTTCCAGAGCTGGCCCGTGTTGCCCGTGTTCATGCAAGTGAGCACGAGCCCGCGGATCTCGTCGGCGCGCGAGCGGTCGGGCGTGCGCA
GCCAGATCTCGAAGCGGTAGTTGTTGCCCGACTCCTTCTTGTCGCGCTTGTTCTTTTGATTCATAGCAAAACGCACCACAGCCACACAATTAGTCGCCAG
CTCCAATGCGCTATATCTTAGTAAGAATGGGCAAACAGCAGCACGTACTTTGTGGATGACTCGCACCCCAGTGATCTCGTTGCCCGGGTCGATCGTCTCG
CCGATGGCGCCTAGCACTAGCTTGTCCCAACACTCGTCCAGCGCCTCGGCACCGATTTCTACAGCGTCCATGCGTACAAAGCAGCATTAGCATGCGTGCC
ACACAGATAGATAGAAGAGAGAGCCCAATGCAAAAGTGCTAGCAGCATACCTTTGCGGATGGACCACTCGCCGCCGCGCTTGTTCTCGGGATCTTCCCAT
TCGGGCGTGATGCCGTCCTTGAAGACCGCGAAGGACTCGACAGTCCGGTCCGCAAACTTCTTCTTCGTGAACCCGTCAAAGAGCACCTGGCTGTATAATA
TCCACACATCCACACACACAGTCCACAATGCATTAAGCCACTGCCCACGTCGCGATCCAGCCGCAGTTCACAGAGATATGTATAGCGACGCACCTGGGTT
TTGGGATGTTGTTCCAGTACGACCAGAACTCCTCGACCGTGCGGAAGCTGCAGAGCTTGAAGAGCTTGTCGGCGTACGCCATACCTTTGCCGAGCTCGCG
CTGTTCCCAGACGGCCCACGCCGTGTGCAGCTCGTGCTTCTCGTCGTCGCCGGAGGCCATCGTCTCTGCTTCTATTGGCTGCTGGTGCTGGAGCTGATGC
TGGTGCTGCTGGTGCTGCTGACAGGCAGGACACACACGCGCGCAGTCGGTAGAGAACGGAAGGTCACAGACGCGCACACGAAG