Description :
From Genome Similarity Track
Location :
Scaffold_332:23596- 24824
Transcript NameFunction/comments
Phypl_g7079hypothetical protein

Sequence
1228 bases(100 bases per row)
GCAATGTCTGCTTTTGCACTGCCGGCGTCTTGGTCattcttctcgtcgtctttcCCACCCGTTAGCACGACAGTATGGTAAAAgcctgcagcaaccagcg
cGACTCGCTTCCCCACAAAGTCATCGATCGGGAAGGGATAGACCCGTTCCGAGGTATCCCCTGTCCCCAGTTGGCCATGGTTGTTTCGACCAAAGACGTA
CATCACCCCGTTGTCCGACACGGCCAACGTGTGGTAGCAGCCACACGCAAAGCGGACGATGTCTTTGCCTTCCAGTTCCTCGATCAGCCTTGCGCTCGAA
AacctctgctgctgcagctgaagatTGGCGGCCGAGCTCGCATGGGGACTTCCGAGACCAAGCTGTCCGTAGTCATTGCGCCCAAAGCCAAACACGTGAG
CTCCACTGCACAGAACAATGGTGTGGTAGTACCCGCAGCAAATCTCCAAACACTCGTGTTTCTCCAATCCCGTTCGCACCTGCACCGGGACCAGTTGATT
CTCCATGGATTCCATGCCAAGCTGGCCGTAGTCGTTTTTGCCAAAGGCGAAGGCCTTGCCGGTAGCCGTCACCACCATCGTGTGGTACTGACCGCAGGCG
ACAGAgaccacgtgctggtcgctCAACGCCTCCACATGCTGAGGAATCTTGCGATCAATGGAGTCGTTGTGCCCCAACTGCCCGTAGTCATTTCGCCCAA
AAGTGTACAAGCAGTGCTGCCCActgccgtcttcttcacacGCCAGGACCGTGTGGTAGTAGCTACACGAAACCAAGCGCACTACCTTGTTTTCCAGACT
CCGGACAAGCTTCGGCACGCTCTCACTCGCAGTGTTGCCGTGGCCGAGTTGGCCGCGGTAATTGTAGCCGCAGGTGGCAGCTCGGCCGTCCGCCGTGACG
ACGATCGTGTGCTCACATCCGTTGTAGGCGTGGACTTGTGAAATGCCGATCGCGTTCAGCTTCGGTACCTCACTCAAATGACTCACACGAGCTGTTCCTC
CTTGGCCGCACTGGCCGTTGTCGTTATAGCCGCACGTGAGGGCTCTTCCATCGGCGGTCAGCGCAATGGTGTGCTCGTTGCCAGCGCCAACCTGAACGAT
GTCcttctgctggagcgccTCGACCCGTTCGAACGATTTCCGCGACGCGGTGTCTCCATGTCCGAGCTCTCCGTACGAGTTTTGGCCACACGTCCACACT
TCTCGgtctcctccgtcgtcgtcgtccc