Description :
From Genome Similarity Track
Location :
Scaffold_264:23593- 24885
Transcript NameFunction/comments
Phyag_g4089hypothetical protein PHYSODRAFT_467853

Sequence
1292 bases(100 bases per row)
CTACGACGATATCGCTCACAATCCGATGCACATTAAAGGAAGTCGCGTCATTCCGAAAGCCTCCCGCGAAGCTAGTGTCACGGCTTCAGATCTGGAAAAT
GAAAAGTTTCGGGGTGGTATCGCGAAAGCAGTAGCTCAAGCTGAAGATCTCATGAAAGATCTCTCTCACTCGTACAATACCTTCCAGTTTGTTGGCGTTG
ACACTGCTATCAGCCCAGACTTGATCAAAATCCTTTTCGAGCGAGTATGGTTTTCATTGCTCACATTGTCGACTACAATTCTGTGTGACAACCAGTCGGA
TTTGTCCACGCGAATGCAATgtctcgatcttctgcgGTTCTGCATCTCGACTTGCTTGTTCCTGAACATGCCAATCGAACGCCAAGCATTTTGCAGTTTG
TTGCGTAAGGTTCAAGATTCGTTGGATGGTACACATCGAGACGAACCTGAGGACCAGAAGGAGGACTCAGTCGCGAAGGGCAGCAAACCGAGCTCAGAAA
ACTCAAAGTATGAATGGGCTCGAGCTAttgaagaagccgcagcaagTGACGATCCGTGGAAGGCCATGGGCGATATTCACCTTCTcgtgaacgagatgaa
ggagacgatTCAGGTTCGTCAGAAATCGGAGAAACTAGACTCGGTGATCCAGCGAATTCACCGTGGCCACTTCTACctcaagaactcgacgacgtTTATC
CACGAGGGAGATCTGACCAAGAAGTGCCGGTCACGTAACCAGCTCTACCGGTTCTTCCTTTTCAACGACCAGCTACTGTACGCTGATAAGAGCATGACTG
GAAAATGGAGCCCGCACAACTCCCTGCGCCTCAAACTCACACGTATTTCTAATATCCCTGACGGCGTCATGTCCAAGAACGCGTTCCAGATCCAAAACCC
GATCAAGTCCTTCGTTGTGTTCGCCGATAGTGCCACTTCCAAGGCTGAGTGGATGCGActcatggacgacgccatcgcagaggcgtccaagaagatcaac
CGGACAGCTCGTCGCATCTCGATCCAAGCATTGGGCGAAACGCGAACATCTCTTGTAGCATCTTCGGCTATGAAGGTTTTCATGCGCTTCGGCTCGCCCT
TGACGTCCCCAACTAATGCAGGGAGCAGTCAGATCAGTCTTGATAGCGATGCTGAGTCTCCCGTAAAACCTGCCGAAGCATTAAAGTCACCAAGCGCACA
AAACACATCAGTAGATGTGACTCCTGCGGAGCTAAAAGCACCAGACAATGCGAATGAAGAGGAACACAACACTGATCACCTCAACACTGACG