Description :
From Genome Similarity Track
Location :
Scaffold_26:235906- 239803
Transcript NameFunction/comments
Hyaar_Emoy2804167PREDICTED: inositol3phosphate synthase 1like putative
Hyaar_Emoy2804168hypothetical protein
Hyaar_Emoy2804169SSP4
Hyaar_Emoy2804170ADPribosylation factor GTPaseactivating protein putative

Sequence
3897 bases(100 bases per row)
TATCCTCTCAGGGTCCAAGCAGGACCATTTGGATGCCGTGCGGCAACACATTCGGGACTTTAAACAGAGCCATAAGCTGGACAAGGTTATTGTGCTCTGG
TCAGCCAACACGGAGCGGTTCTCGGACATTGTCGACGGCGTGAACGACACGTCGGAACATTTGCTGGCAGCAATTCAGGCCAATGAAGCAGAAGTGTCGC
CGTCGACGATCTTTGCGGTCGCGTCGATTCTCGAAGGCTGCTCGTACATTAATGGCAGTCCCCAGAACACGTTTGTGCCTGGAGTGCTGGACTTGGCCGA
GGAGAAGAAGGTGTTTGTCGGCGGGGACGACTTTAAATCGGGGCAGACGAAGATCAAGTCGGTGCTCGTTGATTTCCTCGTCTCGGCTGGGATCAAACCT
ACGTCGATTGTGAGCTACAACCATCTCGGCAATAATGACGGCAAGAATCTATCGGCGCCGCAGCAGTTTCGGTCGAAGGAGATTTCCAAGTCGAATGTCG
TGGACGATATGGTGGCGTCCAATCGCTTGTTGTACAAGGAGAATGAGCACCCGGACCATGTTGTCGTGATCAAGTACGTGCCGTACGTGGGCGACAGCAA
GCGCGCTTTGGACGAGTACACGTCCAAGATCTTTATGAATGGCACGAATACGATTTCCATGCACAATACGTGCGAGGACTCGTTGCTGGCGTCGCCGCTG
ATTCTCGACCTCGTGCTCATTTGCGAACTCGCCGAGCGCATTACACTGAAGAAGGAAGGCGTGTCGGACTTTGAGCACTTGCACTCGGTGCTGTCTCTCC
TCAGCTACATGCTCAAGGCGCCACTTGTCCCACGTGGCACACCCGTTGTGAATGCGCTTTTTGCGCAGCGCGAGTGCATGATCAACCTCTTTCGTGCGTG
TGTCGGGCTTGCACCGGAGAATCACATGATGCTCGAGAACAAGTTGTTTAGCGAGATTGACGGCCGTCAGTGAGGAGGATTGCGTGCGTGCTTGGGACAC
ACGTCGCGATATGGCGTTATTGTGGTATTGTCGGGTGGTGTTTATTGCAATAATACACGACGTTTCGGCGTCGATTCCTGAATAAAACGATAAAAGATAA
AGTCATGTATTGCGTTCGGTCCATGCGGAACAAAGGGTCGTGTACCACCTGAGCGGGGTTACACGTGGCCATCTCGCTGATTGGCTGAAATCGTCTATCG
TGTCACGTGATGCTGCTTTCCAACGACAATTATCTAGCATTTTGAAATATCGAGCAGCTCCGACTTATCACCAACATGGCTACCCCTGCAAAGATGCGTC
TGCGTTCCGACAAGCACTTGGGCAACATCACCAAGCGCGGTCGTGTCTCCCAGCCTGCCAAGGTGCGAGCTACTATATATACATATACCCGTATCGTGAT
AATTGCATCAAATGGGTCATTCTGTTGCTTGTGTGGGTGGTATATATCATGCAGGAAGAAAAGGGGTACAGCGTGGGTCCGTTGCTGCTTGGCTTCCTCG
TGTTCGTGCTCGTGGGATCGTCCCTGATCCAGATTCTCCAGATGGCAAAGTCCAGCAAGTGAACCCACTCACGTCGCGGTGCTTTGGCTTTGTGCGAGTG
CGCGGGAGAGAGACGACGAGAGAGCAGATGTAGTTTAGCAGCGCAATTGCTGCTCCTCGTCGTGTTTTTTTATTCTTCTGATAGAGTCAGTCGACTGTAA
CCAGAACGATCGCGCACTAATTTAATCGAAAAAAACAAACGTTTTGCTTTATTTTCTACAAAGCGCTTTTTTTGTAGTCGATCCAAGTTGAGCAAGAAAG
AAAATTAACCAACTAGTCGCGAACGGGAAATGAATGTAATGTGTTTCTACGTGTCATTATATCACCGACCGACCGACCGCAGTTCTGACGACCAGTGCTT
GGCAATGGACCTCAGCCCTTTGTAATGACAGCTCTCGTGGCTCTACAATTCCGTGCGCATCGACTCGGTTTCCTTGATCTTGGCGATAAAGTCGGCCTTC
TCCACACATCCAACGCACTCGACGCCACGCTCACCCAAAATCTTCCGAAGCTGCTTGACGCGCATCTTCGAGTAGTCGGTATTGGCATCTGTTTGGACGG
CTGCATCAACAGATATACCATCACCAACAACAATAGCAATGACAATAACAATAACAGCATCAACATCAACATCAGTTCCCCAAAGAGTCACAGGATACAC
TAGAAAAGAATGTAGCCATTGTACACAACTGCTCAATGCACGTACGGTATCGCATGGAGCAAAAGTCCGGGTTCTTCTGCTCCAGGAACTTGCAGATCTT
GAGGGACTCCTTGTTGATCCGCACTTGACGAGCCACGTCCGACTTCATTGGCTCGAGATTGTAGCACTATATCAACAGACCATCATCGCATTATCATCAG
TGTATACGTATACGATAATGTACACACTGGGTCAGTTTTTTTGTGCAACTTTTTTAAATCTGAAAAGCTCAACTGGGCATCGTCGTACCAGCTTGTTGTC
TTTCCGGTTGAGCTTCTTGCCGCACTGCTTCGTGACAGCCAATTCAGCCACTTCCTGCTCGTTTTTCCCGGGATTCTCCGTCCTCAGCTGCTCGTACGTG
ACCTTGAGGTCGTCAATCACCTTGACACACACTACATTGAAAGATGAGCTCCTCATTTATTGGTGTTGTTTAGTATACTAAAGTCTAGTGTAATAGTACG
AACCTTCGCATGCTTTTTCGTCATTTTGCAAGGCAGAAGTCGAACGTAGGACGAGAGCTACAAGTGCGACAAGCACGAGACGTTTCGAGCTCCACATTGA
TTTCAGGTATGAGATAGTGGCAGTGGTGCTCCGATTACGAATAATTGAGAAATGATGGCTACTTGTGCGTTTGGTGGACGCGTGGCCAGGGAATATATCG
CCGAAGTTATTCGATTGGTGTAGCTATGTAGCAGATTAGAGGGGTATTAAGTCTCGACGGGCAACGAGAAGCGAAATGTACACGAATAGGTAAAAAGTTG
ACACGATAAATTCGGGGATATCAACTGTGCACAGACTGCCACGTGGACACGACATGGCTACATTTGGGGTAGACGTCGACGAGTGCCTGTAGCCGCGACA
TGACTACACTCAGGCAGGTATCGACATGTATCTACGAGTAGCGCGATTGCAGGTCGTTGAAAAAACCGCTTGTCATGTTCTTGAGCTTTACATATAAAAA
ATGAGTGTGCAATGACAATGAAAATAGTTAGCAAGGTGCACGCCACATAGCAATACTCTTTTGGCATCCCATGCAAGTAGCACCTTTGCCGCCTTGCTGG
CCATACTGTCCTTCATCAGCTGCAATTGATACGCTGCCTCATCGGTCACTACATTTGAGACCCAGCAAACAAAACATAATTTACGAGTAGTTAGCAAATC
ACGAATACGCACTCTCATTCGTAGCCAACGTACTCTCGCCGGAAGTTGATCGGCCTCTTGAGTCGTTTCCGTAGAAAGCATCGCTCGAAATCGACTGCGA
GCCTTGGAATCGTAACAGCTGCGAGCTATCTGCTTGCACCGCTTCACCGCTGAAAAAGTTGTCCGATGAAATGGACTTGGCGTTCTTGTATTTATCGAGC
GTCTGAGCTTCACCTGCATCGGGATGATGCATAATCGGCGGAGGTACAGCTCTGGCTGCTGAGCGGTCACTACAGCAGCGACATACAATGATCAGTGAGA
CGCTAGCACACATCACAGTCTAGTCGACGACACACTTACGCTTCTGCCTCCTGTAACGCCCGTGCTAGTGCTTCGTCATCCTCAATCTGCTTTTCTGCCG
ATAGCTCTTCGGCAATGGGGGCAGGTGGCGGCGGTTTCTACGGACGACAACACAAGGGGTGCGCAAGTACATCAGTAAATGTGTGTCGCTCAGCACA