Description :
From Genome Similarity Track
Location :
Scaffold_743:2359- 3661
Transcript NameFunction/comments
Phyke_g11014hypothetical protein

Sequence
1302 bases(100 bases per row)
tttcaacacTCCTGCTTTTCGCGGCGTGAAGATAAGGCCTGGGCTTATTTGATGCTTCAGCCTCTCTGTCTCCACTACTCCGCGCCACAAATAttgcttc
tgcagttgctccagctcagcaatgaTGCTCTCAGTCGGTTGAAACATGATAGATGTGTAGAGTAGTGCTGGAAGCACAATGACATTCAGTATCAACACCC
GGTCTGCGATACTGGTGtgtttggctgctgcagtcgttaGTCGTCTTCGTATTCTTCGCATCCTGTCTGCCCAGTTGACCGTTCGCATCTCACCAGTACC
CACCTGATAACCCAGGTACCGAGTCGTGATTCCGGGCTGGAGGACCGGGATTCCATGGATCTTGGAGGCTTATGTCTTTGACAAGAAATATGTAGTAGCT
TTTGCTTGGCTGAACATGCAACCCCGACAGTTCCCCGAATTGCTGCACAACTTCCAGTGCCGCTTGTAACTGGTCTGTTCGCTCGAGAAAGATGGTAAAG
CCATCAACAAATGCCGAAAACAcatgctgctcgtcttctttTCCTCCCAGCACCGAGATTCCCATGATGTCTTGGGTTTGTGTAAGGGCTAGTCTCAATA
TTTCCGCTGCGATGGTAAAAAGCAAAGGTGCTAGTGACCATCCTTGACGAATGCCGGTCACTACTTCTACTGGCTCAGATAATTCACCATTCACAAGGAA
TTGggcagtggtggctctgtGCAACTTCCGCATCAGCTCTACAAGCCGAGAATCAAACCCGAATTGTTCCAACGCCACCAGCATAAAAAGTCGGCTCAGG
GTATCGTACGCTTTCTTGAAGTCTAGTAGCAGTATCCCCGGGCAGGAGCCTTCACTTTTGACCTCCCCAGACGTCGTCTGCTGTAAATGCGCCAGCATCA
TGACTACTGTTTTCTGTATCTGTCGACCGTACACAAATTCTTGCTGTGTCGCCCCGATGAGTCGTCCCAAGAACTTCTGCAGATGTGTTGCTAGCACCTT
TGTGAAAATGTTGTAGCTTGTTTGCAGGAGGGTAATGGGTCTGTAATCCATCGCGTTGTCTGAACTACCCTTCTTCCGCAAAGGAATTATGTCCGCCCCT
AAGAACAATGTTGGTAAATCTGTGCCTGCTAACAAAGTGTTGTTGAGCTTCGTCAGGATTGGTATGAGAATTCCTGCCGTGTCTTTGTAGAAATCATTAT
TCAGTCCGTCAGGTCCTGCTGCTTTGTGGCGGTTAAGTTCGTCAATAGCTACCGCCACTTCGTTCGTCGTGATCTTCGCCATAAGTGTCGCGTTATCTTC
TG