Description :
From Genome Similarity Track
Location :
Scaffold_472:23587- 25760
Transcript NameFunction/comments
g13831.t1hypothetical protein

Sequence
2173 bases(100 bases per row)
AACATGCCCGGCGCCGATCACAGCTCACACAGGAGGAGCGTGCCGAGGAACGGATAGTAAACCAGGAGCAACATGCCCAGCGCCGATCACAGCTTACGCA
GGAGCAGCGTGCCGAAGATCGCATGGTAAACCAAGAGCAACACGCGGAGCGCCGATCACAGCTTACGCAGGACCAGCGTGCTGAAGAACGGATGGCAAAC
CAAGAGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGAGGAACGCGCCGAAGCGCGAAGGGTAAACCAAGAGCAACATGCGGAACGCCGCAGAGAAC
AGACTGAGGAAGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGT
GGCCTACGTCCAGGGTCCAAACGTTGTGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCC
AAAATGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGCCTGCACCTCCAAGATTGTTGCAACTGTATCGGGATCCAGCGTTTCGACAGC
ACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGTGCTTCGTGCTCCAACCGATCCTTCCAGGACGTCAACCAGGATGCAAGCGTAGCGGG
ACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACGGAC
CCTAAATTCGCGCAGATCTACATTGTGGACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATTTTTGCTGACTTGGATCCTGTGGCGTTGATGG
ACATTGAGCAAATGATGGAGCAGCACAACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGATAT
GGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTGGAT
AGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTACGACTGTTCGAGACGCGCCCGGAGTATGATCCGCTTCAGTATCCTCTTCTGCTTC
CGTATGGGGAGCTGGGTTGGACCTACACGGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTTCCG
GTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACGCGCTAAATGCGAGCAGGAGCAA
CTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACCGAGGGCTTCAGGATGCACTGCTTAACGAAGGAACAATTCAGCTGGAAGCAG
GCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGTGGTGGTGATACCCATTTTCTCAACCAAGTGGGACG
CCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCGATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGAGAATTCGGCAAGCCTGAT
GTGTTCATGACAACGACCTGCAGCCCTACATGGGAAGAGATAGTCGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGACCGCCCCGATATTGTAGCCC
GTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAAGAG
AGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACGTACTCGCCAAATCGTAGATCGTATGGTGTCTGCAGAGCTTCCTGAC
AGAGAAAAGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGACCATGTGGAGCGGCAAACCCGTCATGCGCTTGCATGAAGGACGGGA
AGTGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAG