Description :
From Genome Similarity Track
Location :
Scaffold_4:235869- 240139
Sequence
4270 bases(100 bases per row)
GTAATCGTACAGGTGGCCACCGCACGAGAGATTGGACGCTGGTTCCCATGTCGGCTCGTCATAGCCGACCCACTTCACCTTGAACTCTCGGACGGCCCGG
TGAGTGCTCGTTGACAACGGTGTCCGGTCATCGAGGATAGCCTCGACTTCATACTCACCGTCCAGGCGATCCGGCTCAAAACTGTCTTCAGGCAGTAATT
CCTCGTCGAAGTCAAGACGAGTGTCTTCGGTGACCTCACGAGCCAAACGAACCCTCGGTCGGCCTTCGAACTCGTCCACTGACTTGAGTCGTGAAACATG
CACCACCGGGTAGAACCGGTATCCACTTCGGTCGGGTAATTCCAACTCATACGCAAATTCGTCGACCTTCTTCTTCACGCGGAACGGTCCGTGCCACCGA
TGGGCTAGTTGCTTGGTCAGTCCTGGTCGAACCCGCTCCATGTACAGCCACACTCTGCTCCCGGGCTGCAAAGAAAACCTCGTTCTCGTCACTGCAGCTC
TACTATGGTCAGGGGAACTCGGTGCCCGGTCGACCGAGGTTCTATTCTCGTTGACGCCTGCCATGGCTTCCTTCTCCTTCCTGCCAAGCGACGCATTGTG
CTCTTCAGCTCTCCGAGCCTTTTGCGCGGCTTGGTACTCCTTGACCATCCTCAGGGCGATTTCCTGCTGTCGGTTGACCTCTCGGCGCCATGCTAGCGCG
TCAGTTTGGCTACCGAAGCCTCGTTTGAGTGACAAGGACATTGCCTTGAGCGTCGACTGTGCATCCCACCCATGAACGAGATAAAACGGAGTTTCCTTCC
TCGTCGTATCACGGGAGCTATTGATGGCGAAGATCAGTCTTTCGGCGATCTCGTCCCGATCCTGCTGTAGTGGGTCTTTAGCGTATACGCGGACTGACTG
CATGATCGTCTTCACCGATCTCTCCTGCTGGCCGTTGGCCTGCGGGCGGTAGCTCAGGGTCGCTCTCGACCGAGACTGCATCATTTCCGCGAAGGCTTGG
AAGACCTCGCTCATAAATCGAGGATCTTGGTCATGACGGATCAAGGACGGTACTCCAAAACGTCGGTAGACACACTCTTCGAAAGCTTGCGCAACGAGTA
AGGCGGTAGTATCAGACATGGCTTTGCCCATCACGAATCCCGTGAACGAGCATTTGAAGAGCAGGATAGCCGTGTTGCCACGGCGACTCTTCGGTAGCGG
TATCACGAAGTCCATAGAGACTAGTTGGAAGGGTCTCTCGGCTAGGATGTTCCCTGGCGAGTACCCGCGGAACTGAGGTCGGCTCTTACTTGAACTCCAG
TCAGGGCACGACTTAACGTGTTTCTCCACATCGGCATACTGGCCGATCCAGTAATAGTCTCTTGCCGCTCGATGTAGCCTACGGGTAATACCTTGATGAC
CGCCTTCAAGTGAGTCATGACAGCTTTGCAGGACCTCTTGGATCATCGTTGTGGGCACCACGAGTCTCGTCTTCAACTCGGCTTGCTCGCCGTCACTTGA
ACGACGGCTCGTTCATGTGTAATATAGCACATCGTCCTCACTCAACACAAATTGGTCCGCCATTTTCCATGCATCTCGTGCTGCTCTGTATCCAATCTTC
GCATCATCTCCCCGGAGCACTACCTTCAGATTCGACCACCGTAACTCTTCATCTTGAGCGGAGGCGATTCTCCTTCGGCGTTCTTCCTGTACTACCAGCG
GGTCAATGTCTTCTGCGTTCGGTGGGACTGGTGACGTCTCGGCACGCAGCGGTGAAGCTTCTGCTTCATTCTGAGACTCGTTCGGTACACTATTGGCTTC
TACTCGGTGAGATGCGTCTCCCTGATCGGTGATCGAGACTTCATCTGCAAACCGGACGTGTTTCTCCTTTGCTCTCGTTTGACGTCTGGTCATCACAGCT
ACGTGTCCGGGTTCAGTCTCGTTCTGCCGTCTGCGGTCGGTTTCTCTTCGCACAAAATCGAAAAAATTCTTGCTACGAGGTTTGGCAGAAGCTATCACGG
CCCATACTGTGTTGGCCGAGGGTATGTCCTCGACGACGCAACCGTCAGCAGCCTCGTAGATGACTTCAGCGATACGGTTCAGCTTAATCAGCTCTAATAC
TCGGTCGTCCGACGATACCACCGTAGACTCCTTGCACTCGAGAGTCTCGCTTGCCCGAGAGTCGGCCGCAGCGTTAAACTCTCTCACCACATGCAGGTAC
TTCACCGGCCGAAGCTTGGCCGTGAGTTCTTGGTGGTGGCTGAGTTGTTGCAGCAATGACTCCTTCCGACAGGCTATCACCCCTAGGGCTTGCTGGATCG
CGAGCCTCGAGTCGCCAACGACAACTAGATCGTCGGCTTCGTGCTGTAATGCAGCAGAGACGCCGTTGTTCATCGCGGTGTACTCAGTGAGGTTGACCGT
GGTGTTCTCGAGGTAAGCGCTCGCAACAAGCACTACTGTCCACACTGGTAGCTTCCATAGTATCCACGAGCAACTGCCGTATCCACCGTTCTTCTCGGTC
TTCGCAGACCCGTCAAACGACATAACGAATCCTCGGTAGGACCGCGGTAGGCGTGCGTAGAGCAGATGCGGGTAGTTGGTGACCCTCGTGTCCGGGGTGT
GACCAACGCCAGTGACTTATCCAAGTCAACGAAGTTCGTCAAGCCGGCTTGAAGTAGCCGAGCAAACGAACAGTCGGTTTCTTCGACTCGTTCGACCAAC
AGGTGCAACGGCGACAGCAAGACGGCGAACTGGGTAGCCCGACCGAACAATGTCTTGGACTTGTGGACCCAGTCGAGTGTCGAAAACCGAGTGTATACCC
GGATTCGCTGTCCAACGAGTTGAGTATAACACACCTTCAGTATCAGCAGAAGCGCGAGGACCTCTTTCTCGGCCGGGTGATAATTCATCTCAGCATCCTT
CAAAACACGTCCGCAGAAGCGAACGTGGTGTAGTTTGCCCTCGTGCTCTTGCATCAACGTGGAACTTAGAGCCCACTCGTTGGCGAACAACATGGCATGC
ACCTCCTTCTTCCGGTCGAAGTGTCGTAGTATCGGTGCTGCTGAAACCTTCTGTTGGAGCATCGCGAAGCTGTGCTTGGCCGCGGTGAGGTCAGCCCCGA
GCTGGAAGTCCTCGTCCTTAAGCTGGTACAGCGCTGCTCCATAGACCGCGAAGTCTTGGATGAAGCGACTGTAATAGTTGAGTGCCCCAAGGAAGGACTG
CATTCCTTTCCTCGTTGACGGGAACGGAAGCTCGGCCACCCCCAGCCAGCTTCTTAGCGTCCGGTCGGATACCTTCTGCCGAGACTTCGTGGGACAGGAA
GTCTACCTTGGACTGCACAAAGATGCTCTTCGTGAAGTTGATACTAATACGGCACTCTTCAAACCGTGCCAGCAATCGGCCTAGCCTCGCCAAGCACGAC
TCGAAAGTCTCGGCACCGAAACAGATATCATCCACGAATGACCGGCGACTGAATACTGGTAGTCATCGGGCTCCCCGTTGGCGAACATGTCGGTGATAGG
GCTGTTGACCACTTCGGCTACAGCTCCCTTACCAAGCGAGTTGTCTCGGTCGGCCTCGAACTTGGTCCGGAATGGCTTTGCCGTGCCAGTCGAAGCCTCG
TTCACCCCAGCATGAGCTTCCTTGTCATGTTCTTCAGCTAGATGCATGCGCTCCGAGAATTTAAACCATCCCCCCGTCGGTTGGACGAAGCCCCAAAGCG
CGTTGTCAATCATGCGTTGATAGATCATCGGTGCGTTCTTCAGGCCGAAAGGTATACGCAACCATACGAAGTGCCCCAGTGCGCAGACGAAAGCAGAGAT
CATCCGAGCTCGTTCGGTCATCATAATGGCTCAGAAGCCGCTAGCGGCGTCAAGCGAGCAAAACCACAAGTACGCCTCCATGTCCGTCAGCAAGTCATCC
ACCAGGGGCATGGCGTACTCCATAATCTCGGTGATCGCATTAACGAGTTTGTAGTCGATACACAGGCGGATTTCCACCCCATTCTTCTTCAGGACGATGG
CGATTGGCGACGCCCATGGGCTGTCCGAGAAGGAGATAAGCCCGGCCTTCAACAGACCCTTCAGCAATTCGTACAGCTTACCGAGGAAGCGAAGCGGGGT
CCGCCGAGCCTTCTGCTTGATTGGCGCGTGCCCCTGTACATTGATGTCACACACGACCCCGTAGGCTGGAGGCGGCAGGGCGTTACCGCTCGCAATCATG
ATATTCTCGTGGCTCTTCAGCACATCGACCAATGCCGTCTGCGGCTTCACGCTGAGTTCGTCACTCTGGA