Description :
From Genome Similarity Track
Location :
Scaffold_184:2358- 4361
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_184-snap-gene-0.12Vacuolar protein 8

Sequence
2003 bases(100 bases per row)
TCTCCGTTCGTTTGCCATCTCACGTGGTTGTAGACTCGGCTGCTGAGATCTTCTGTGCCGTCGGCGGGATGGAGAAAGTGATGGCGCTACTGTCCGGCAA
AGCGGATCCTCGAGCGATCTACCTAGCTCTAGAAGTCGTCAACGCGTTGTGTGGCTGCAGCTGTACGTAGCATCAAGAGGTCCTTATGTTTGTCTCCGCA
CTGCAGCGATTCTGATCCGGTCAACTGTGCTGTGAATTGGTCACATTCACACTGTCCACTGCAGCCGCGATGGTCGAACGATTCTGCCAAGCTGGACTTA
TACGAAATCTGTGCAATCTGTCAACGAGCGAGTCGGCTGAGCTGGTCAAACTGTCGCTGCAGATCCTATCCATGACACTTCGCCAAGGTAACAGCACTCT
GCAGTAACGACACCGACAGGACCAGACTTATAATCTTGAGACATTTTGCATGCGATGGCCGACAGACCAGGTGAAAGAGGAGATCCACGCCTGCGGCATG
CTTCCGATACTGGTTGGGCTCGTTGACTCTCCAGTCGCTGACATTGCGCGAGCTGCAGTAGTCTGCATCGGCCAGTCACTCCCCAGTGGTGAGCTCCCCA
ACTTTGCAGACTTTCCCGGCTCGCTAGTTTGTGGATGCTGGGTTTGCTGAGCTTGTAATACTGCTGTAGCGAAGAATCTCAATGAGATAGTACGGCTCGG
TTGTATCGAACTATTCTTGAAACTCATGACTCCGACCAACCGCAACGCGGACGCCGTCATCTTTGCGCTCTCTCTCATCGCCGAGGAGACCGACGATCCC
TTCCCGCGCGACCTGACGCTGACCACGACGACGAGAATGTTGGAGACTTTGCGTGGCGGCGCCAAACGCTCCAAGGCGGCGCGAGCCATGAGTTTTCTTT
GTGCGAGTCTGGCCAAGTCGAGCATCTTCCATTCGGCTATCTGTACGGAACAAAACCTGTCGATCCTGTCCAAGTTACTGGTTGGTGGGTCGAACGACGT
GCTCTGCGCCGCTGCCTTCGCACTGGGAGTAGTTGCACTGTATGGGAACGACCGCGTGAAGCATACGCTCTTTGTCGTGGACGCGCCAGTCAACCTCGTT
CAGCTCATCGTCTTGTCAGCGCCGCTGTCGTCAGCAATATCATCGTCTCTCATGAGTGAAAGCGAGCTAATTATCCGCACGTCAATGTTCGCACTGGCGG
CTGTGAGCGTCGAAGGAGTACTCTTGTCGTCCGGCAAGCGCGTATTCCCCGAGCTCGAGTATTCTGATCATCTGCGAGCAGATTTGGCAGTACTTGCTGA
GACTATTCTAGACTCGAAGGTGGTTCAAAGCGCTTTGGACCTCTCGACTGTGCGTCAAGATATTTGCTCGACATACGCACTCAAATTGATGATCCTAGTG
AGCTCATGCGAGTCGGTCAAGCGATTGCTGTGCACTCCAGAAGGCGTTCAGAAGTTGCTCTGCTTCGCGAAGGGAGCCAGCTCGGCGTTTATTGGCTCTG
TGTTCATGCTGCTCCTTGAATGCTGCACTCCCAAATCGTCGCAGTTAACGCAGCATATAAGTCAACAGCAGCAAAAGGCAGATGAATTGGCGATCGAGTT
CTCCAGAATGCTGGAGCAGGCTGACGATATCCCGCACTTGTCTGGGACGATCTTTCGTGAGCATGAGCCTAAACACTTGCTCGGCTTTCCGGACCTCCTG
AGTCAGTTAGTGCTGAACTCCCCAACACTCAAGACTCACCTGAGCACGCGCGAGGTGATTGACGATGTTCTGGTGGCGGCATCACGCTTGAACCATGCGG
TGCTGCACAATCAAGTCGTTTCGTTCATCGACGTTCTAACGGCTGGGAAGAACCAGAACGCGATTGTGGCGCTGTTCGAGTGCAGACCCGACCGCGTGGC
CAACCTTCTGCAGGCTTCTGCAAGTGCGAAGGTGCAGCTGACGGCAGCGAACGTGCTGCGCCGCGTCTTCAAGCGCTTGAACAGCAACGATGTGCCGTCT
GCA