Description :
From Genome Similarity Track
Location :
Scaffold_1115:2358- 4189
Sequence
1831 bases(100 bases per row)
TCCGTAGTAGCTTCAAACGCGATTGTCTGCCACTCCTGATATTGTCGTGACCCCATGGAAACATTCCCGGGTGATCGCGGTATCATGTCCTCCTGGAATT
ATTGTCCGAAGGGCGTCCCTTGTTGGGTGATCACCTCTTGATCACTAAAGTTAGTCAATCACAGGTACGTTAGTCCTCCGGGTTCGGTCGTTGTATTAGG
TACCCAGCTTGAGTGTCATTTTAACCACATTTCGACTGTGGTGGCCCCCGACCAACATTGACTTCGACAGAGTTATCTACCGGGATCGTCAGGTACATCT
CATCCGCGGCAATCCGTTGTATCTTCGCCCCATACTGTGGACTTCTTCCTTCTAGTTGAATCCTGACATCGTCCGGCAAACAGACCGTCCCGTCGGCTAG
GACAAGGCTTATCCCGGTGGGTACCATAAAGTCCATCCCCGAAATCGCTTCTTGCCCACTTGGTCACCAACCCATATATGGAAGTAGTAGACTGGTGAAC
CGTTAAACGTGATCTTTACTGTCGTGCGGCCTTTGGTCATGTACGAATTCTATTTGATACCCACGCATTCTTGCTTCTGACTATCATCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCCTGCCTTCGCCTTCCTGAACCATT
TGTTTGGAGTGTGATACTTCCAGTTACCATGTGATTCACCAGGAGACAACTCGAGTTCCATCCTGGTAGGTGATCGTGCATATTCATTCGGTCGCCTCAT
ACTTGCGATTGAAGGCAAACATCTTAGATCCAAATCACATGTACTGGAAGTCCGACCGGTCAGGCGATTAACTCTATTATCAACCCCTTTTCTTTCAATG
AATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGACCTCGGCGTCCGCATTTCTAAAAGTCAATCGTTTCCAGAATCCACGATCATCATGTCTTTTCGAC
CAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTGAAGTGTATGGTGATTTCGATCGTGAGAGGAACTTGCTTGAACTGGCTGGGAGGTTGCCG
TTGCGTTTCTGTATACGTTCGTACGTGTGTAGCGTTGCTTTCAGTGTATTCACGTCATTTAATCGCAGCGGCGTTAATTGTTTTGAGANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATTATAATGGCGACCAGCGGAGACGTCGATCGACTCA
ATTGAGAATACCAGTTTCGTGCTGGGCCTGT