Description :
From Genome Similarity Track
Location :
Scaffold_1101:2358- 4167
Transcript NameFunction/comments
Phyag_g9492hypothetical protein PHYSODRAFT_518156

Sequence
1809 bases(100 bases per row)
ATTTTCAATGTGGAAGAGGCCACGGAGAGATCGAGAGCTCATTCCCTTAAACTTGCTGTCGTTTCGCTTTAGCATTGGTCGGGTGGGTTTGGCGGAGCCG
TCAGTAGTAGTGCAAGTGGTTGCTGCGTTCTCGATCGCATGAGTATTTCTTGCAACAAGCAATGCAGGATCCACTAGCAGGGGACGTGGTGGAAGATAGG
AGTCACCGCGAGAGACAACTAAatcatcttcgtcctcattCAGTacactctgcagcagcagtggatgGTGGTGAATTTGGTGAGTGGCGTCAAACAGCAC
TTCACTCTGCGCTAGCGCAACTAGCTTGAGTAACTGGGCGTACTCGATTTGCATCTCTTTCAACTCGAACAGCAGCCTGGTTACGCTATTAAAGCGGAAG
CTTGACAGATGCAAACCAAACGTTCGCAACACCAAACGCATTTCCTCCACACCGATTTCACCAGAACGGCTGGGGTCATTCGCCTCTAACTCCGCCTGGA
GGTCTCCAATAGATAACTTCTTCGCTTGCATGTTGTCCCACAACAAAACCGCGAACTCGGAACGCAGCTCGACGATTTCACGGAAATGGTCCACGACTTC
ACTCAGCGTGCTGCCGTCCACGCGAAAAATACTGCTGACCAGGACAAAGTTCCTGAAAAtatgcggctgcagcagtaaAGTATTCAAAACCAAAGACACT
GGAATCGCAAGCACCTCAACTATGCCTACATTGGCGTAGACGATCGCGATCTGGTAGGCCACGCATAGTACGACCAACGCGAGGTAAAACCCATTGagca
tcaacagcatcatGACCGTGAAGTGCCACGACTTGCGTGAAAACCATCGAATTTCGATCGCCGGTGTTGTCTCCGTCTTCAAATCGCACCTGGTGGCTTT
TGGACGGCGCATCTTTCGCTGTCTCGGtgcctcgtgctgctcttgtACTTTTTGCATGTCCAAAAGTGCTTTGcctgcgtcttcttgcgtCCACGCTCGA
GCTTCCTCACGTGCGATGGATCTGAGATGGTTCTCCAAAGTAGTTTTCTCCGCTGATATTCCGGCAGCGTTTAGCAATTGCTGGACACACGAACGGAAGt
aaacaagaacaacaatgtgcagcgccaccaacgccCAAGAAAACCCGACCAAAACAACCACAAGACTCCGCCGTTTAGTCAGCTCCGGCTCATCGTAACT
TATACCCGTCGTAATCCCGTCCAACGCCCACGCCACAGCAAGTAGTAGCGCCCACATCGGCGCACTCACATCGGTCATATGTGTGATCTGGTTATTCTGC
GCTTGTCGAAGGTACTTGGCAAATGGGAAGAGTTGAGGCAGATTGAAGCGACTGAGGAACAAGTGACGCAGCAGGcgaagctgcacaagctcCTCTGTAT
CTCGTGATTTACTGGGACCTGACAAGGCCACAGCATCGGCCACGTCTtgcgtcgacagcagctcagcTTGGTCAGCTCGAACGTTGTGTTTttgcaggac
gaggaagatgcagACGGTCTGTAGGATGAGTGCCAATGCCAGGATGAAGATGGTCAGGTCGGCCACCTGGAAGGCCGTCATGGCCGCACTGCCGCCGTCT
ATAATTGCAGTTTCCTTGGCCAGTTTAAGGCCAAGGCCAATGAGGCCGAGGATCATGAGCTCACGGTACGCCTTGCTCAGCAGCTGTTGGTACTTGGCGG
AGACGGCGGCGCGGCGCTCCAATTGGTGCAACGCGCgctcaaacagcagcaagaacaccaccaacacactcagatgcagcaacacgcgCCATAATTCCAC
ACTCTCCCC