Description :
From Genome Similarity Track
Location :
Scaffold_1115:2358- 3941
Sequence
1583 bases(100 bases per row)
TCCGTAGTAGCTTCAAACGCGATTGTCTGCCACTCCTGATATTGTCGTGACCCCATGGAAACATTCCCGGGTGATCGCGGTATCATGTCCTCCTGGAATT
ATTGTCCGAAGGGCGTCCCTTGTTGGGTGATCACCTCTTGATCACTAAAGTTAGTCAATCACAGGTACGTTAGTCCTCCGGGTTCGGTCGTTGTATTAGG
TACCCAGCTTGAGTGTCATTTTAACCACATTTCGACTGTGGTGGCCCCCGACCAACATTGACTTCGACAGAGTTATCTACCGGGATCGTCAGGTACATCT
CATCCGCGGCAATCCGTTGTATCTTCGCCCCATACTGTGGACTTCTTCCTTCTAGTTGAATCCTGACATCGTCCGGCAAACAGACCGTCCCGTCGGCTAG
GACAAGGCTTATCCCGGTGGGTACCATAAAGTCCATCCCCGAAATCGCTTCTTGCCCACTTGGTCACCAACCCATATATGGAAGTAGTAGACTGGTGAAC
CGTTAAACGTGATCTTTACTGTCGTGCGGCCTTTGGTCATGTACGAATTCTATTTGATACCCACGCATTCTTGCTTCTGACTATCATCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCCTGCCTTCGCCTTCCTGAACCATT
TGTTTGGAGTGTGATACTTCCAGTTACCATGTGATTCACCAGGAGACAACTCGAGTTCCATCCTGGTAGGTGATCGTGCATATTCATTCGGTCGCCTCAT
ACTTGCGATTGAAGGCAAACATCTTAGATCCAAATCACATGTACTGGAAGTCCGACCGGTCAGGCGATTAACTCTATTATCAACCCCTTTTCTTTCAATG
AATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGACCTCGGCGTCCGCATTTCTAAAAGTCAATCGTTTCCAGAATCCACGATCATCATGTCTTTTCGAC
CAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTGAAGTGTATGGTGATTTCGATCGTGAGAGGAACTTGCTTGAACTGGCTGGGAGGTTGCCG
TTGCGTTTCTGTATACGTTCGTACGTGTGTAGCGTTGCTTTCAGTGTATTCACGTCATTTAATCGCAGCGGCGTTAATTGTTT