Description :
From Genome Similarity Track
Location :
Scaffold_238:2358- 3796
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_238-abinit-gene-0.64Centrosome-associated protein

Sequence
1438 bases(100 bases per row)
CATGCTGCAACTCGATCTCTAGATCTTCCTTCTCGTTCGCAAACTGGCGTCGACTCGTGTCCAGTTCTCCATTCTGCTTGATCAGCTCCGAGATGCGCGC
TTGCGCTGCTTTCAGCTGCCGCATCACGTCTGTGTTGAGCTTCTTCATGTCTACAAGCTCCGCATGAAGCATTTCTTCTTGTTCCAGGTACGACGCAGAC
TTTGCCGCGCTCTCGAGCTGGCCCATTAGCACTCTTTCCCGAGTCTCGAGAGCTTCAATCCGGGACTTGAGCCGATTCACTTCCAACGACTGACCATCTG
CCGACGAGCGCTTGAGATTCGACAGCAGCGGTAACTGGGCTTGCTTCTCTTCGAGCTCTTTCTCCAGCTCCTTCCGACGCTCCTGTTCGAGCTTCATCTC
CTCCTCGATCGCATCAAGTCGCTTACGGAACGCCTCCCATTTCGTGTTGCGCACAGTCAAATCGCGCTCTTTGACCTGCGAGATCGTGGTCTCCAATACA
GCAACCTGGTTACGAGATTTGTCGCGCACGTCGCTGAGCAGCTTTGAGCGGTTCTCCAGCTCCAGTTCCAACTGCTGTGCTTTGATCACCGCTTGCTGCT
GATCATCTGCTAGAGTGTCGTACTTGAGTAGAAATTGCTGGTAGTTTGTCTTGAGTTGCATGAGCTGATGCTGCAACTGGCCGACAACTGCGTGGTCTTC
CGAGGAAGCCATGAGATCTCGTAGATGCGCTTTCTGTTCGTCACGTTTTCCTTTTTCCTGCGAAAACCGCTTAGACAATGTGTTTGCTTGGTTGGCTGCC
AATGCAGCGATGTCCTTGTACTTTGCGCACTCGCGCGTGAGACTCTCGTAGAGCTGCTCGACTTCACTGATACGTTCGAAGAGCAACGCGTTCTCCTTTT
CCAAATCGCTCTCGTACAGTTCGAGTTTCTTCCTGTCAGTGCTCTGGTCGCCACCCATGTCACCAACAGAAAGCAGCGGTGCAAGTGCCAAGACAGATGC
AGTAGCAGCCGTGTTTCGAGTTGCTTGTGCTTCTTCGATGTCCTTCATTCGCTGCGTTTGAACCATCAGCTCGTGTTCAAGTTGGCTGATGCGCGCTTGG
AGAATCGGATCGATCGAAATCTTGTCGTTTGCTGATTTCTCACCAGAACCGTTGCTTGCATGCTTCTCAGCGAGCAATAAGGCGTTTTCGTGCTGCACGC
GACTGATCTGGTTTGGCAAATCGTACATTTGCACAAACTTGACGTGCATTTCAGAGTATGCTTCGCTGAGTGTGTTGTATTTGTGCAGAACTTGGAGCAT
CGCCTGCTCTTGCCGCTCTGCAAATGTTTTCAGAACACTTTTGTCCAGCGTCTTCTCCATGCGCTCGATGAGCTCGTCAGCGCCTTGCTTCCAGCTTTCC
AGGTACAAGATCCGATATTTAAGCGTCTTCTCCATGTC