Description :
From Genome Similarity Track
Location :
Scaffold_100:23569- 25302
Transcript NameFunction/comments
Physo_141521gag protein

Sequence
1733 bases(100 bases per row)
AAATACAGTCAGTCTTATAACCTACTCCTTTGTAGCAAACCGTTCCATTTGAGGCCGGGAACTGGTGAACTGCCGCACGCACTTCCTCTGTGCATTGTGC
TGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGTCTACCTGAATCCTCGGTGGCTCAGGTCTGTGAGCCA
CGATGGACCGAAGTGAGTTTCCTCACTTGACTGACTCGCAGTTCGAGTCGGTGCGGAAGATGGCGGGCATCTTCGGAAGAGATGCCCTCCGGGGCTTGGC
GGCGACGCCAGCCGAGCAGGTCGAGCGGGTGAGCGCGTTTGACGAGTACGAACGCGGGCTCATCGCTCATGTGCAGGGAAACCTGCTGGCTCAGATGAGT
GAGCCCAAATGGGTGCAGCGTAAGCCTCTGCGGCTAGCTGTGCCTCCGTTCGAAGGGAAGGAAGGTGAGAACCTTCACTTCTGGATCCGGGAGACCGAGA
TCGCAATGTGCGCAGGTCTCATCTCGGCCGAGAACCTTCGAGTCGCCTTCGCGCTCTCCAATCTTGGCGGACGTGCCAGGACTTGGGCGTATATGCGCGA
AGCGATGTCGCCTGGATGTTTCACACCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCTTTTCTCCCGGCGAACAACGAGTTCCGCCAGCGCTCGCGC
TTCCTTGCCTGCAAACAAGGGGAGCGCGAGCTGTACGCGTACGTACAGGAGATGTGCACGTTGGCAACCTCGCTGGAGGGGAACCCACTGTCGGAAGACG
TCAAGATGACAGTCTTCGTGGACGGCCTGAAGGTCGGTCCTGCGCGCACGCAGTTGTTCCGCGTGCGCACCGCCACTATGGAGGAGGCGATCCAAGTCGC
CCTCCAGGAAGAGTACAGCCACAAGTAGGCTGGTGCTCTTGCTGTTGTACAGCCTGTGGTCGCTGACAGCGAACCAGAACCCATGGATCTGAGTTCGACT
GAGCAGTACTCAACCCGCTGCTACGGCTGCGGCGGGCTAGGACACTATCAACGTGTCTGCCCATCGTCTGGGTCTGGGAAGAAGACCTACCCGAAGACCA
GAGGGTCAAGGGGGCGCCGACGCCATGCACCGTCAGGTGCTCAAGGGGGACACAACCACCAGTAAGGACGAGGGCCTTGCTGGGGTTGGCCCGAGTCTTT
GTGATGGGTGTACGGAAGGCGTACACCACAGAGACCCGGGGTCCCTTGCGAGCACTGACGCTCGCATTGGTGAAGGACAACGGTGGGTTGTCGGTAGTAC
ACGTGAGTGTGCGGGGGTAATGGTATCCCTAGACATGACTGAGTCTGGGACGTCGCGTGGATGTTCGCACGTCGCCAGATGTGTCGGTTGGAATAACGAC
ACAAGTGCCGAGACTCTGCGAGAGAGTCTAAGCACAAGGTCAGGTCTCATTGACTGAGGCTGGGCCGAAGAAGAACCTTGGGGTCCGCTGTGACCCTGGC
TGCCGCGCTCGAGGGCACTGACAGCAATGGAACCGTACATCGTCCCGGACATCGTGCCGAAGCCGGTCCTGGGCATGGAACCGTATATGTCCTCGGCTTG
AGCAAGTATGACTTGGTCCTGAGTGCGCCGTGCAAGCTGCACAGGCTCTCGGTCGAGTAGCGCGGCAACGCCTTGAGGCTAAGCCGGCCCTCTGTGTCTG
ACAGAGCATTGGTGAGTCATGTTCCCACCTCTG