Description :
From Genome Similarity Track
Location :
Scaffold_317:23566- 27381
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_317-fgenesh-gene-0.2GPI ethanolamine phosphate transferase
Pytap_DAOMBR444maker-pag1_scaffold_317-fgenesh-gene-0.6Protein phosphatase 2C

Sequence
3815 bases(100 bases per row)
GCTgCTGGTGCTGGGCGTCGTCTTCCACGCCGTCTACGTGCTCAGCATCTTCGACATCTACTTCACGTCGCCTGTCGTCCCCCAcGTCGAGTCGCTCACT
TATGCAGACGCACGAGCCCCTGCGCCCGCCAAGCGCGTCGTGGTCTTCGTCGCCGACGGCTGTCGCGCCGACAAGTTCTTCGAGAGCAACGCGTCTGCAG
CGCGTGAGCCAgAGCCAAAGCATGTGACAGAGGCGTCGCGCCGCGTCCcGTTCTTGCGCGATGTGGTGGAGCGCCGCGGCTCCTGGGGCGTCTCACACAC
ACGCGTGCCAACTGAGTCACGACCTGGACACGTCGCGCTCTTCGCTGGCATGTACGAGGACGTGAGCGCCGTGACCAAGGGCTGGCAGGACAACCCCGTG
GACTTTGACTCGGTCTTTAACCAGAGCCAGCATGCATGGCTCTTCGGCAGTCCCGATATCGTCCCCATGTTCGCGCGTCGCGTGCCACAGGCCACAGAGC
TGCACTACTCGCACGAAGAAGAAGACTTCGCGTCCAAGGACGCGTCGCAGCtcGACGTCTGGGTCTATGAGCGCTTCCGCGAGCTTTTGCTGACGCAGGC
GCCGCAGAACGAGACGCTTGACGGCGAATTGAGGGCGTCGCAGGTCGTGTTCTTCTGCCACTTCCTGGGCATCGACACCAACGGGCACGCGCACCGACCG
CAGTCAAGCGACTACCTCAACAATATCGCACTCGTAGACGAGCTGGTGGAGAAGATCGCTCGCCTCGTGGACGACTTCTATGACTACGACGGGCAGACag
CaTTCGTCTTCACGGCAGACCACGGCATGAGCAACAAGGGCGCCCACGGGGACGGCGACCCGAGCAACACCCGCACACCACTCGTGGCCTGGGGCGCCGG
CATTGCTGGTCCCGAAGAAGTGCCAGTCGCAGATGCGTTTCgCATCGATCTGCCGACTCAATCGCGCTCACAAGTCGCTGCACAACTGACTGTCCAGCGA
GAGCAGGAGGCTGCAGCCCTGCGGCAGTGGCAGCTCGGCCATTTGACTCGGAAAGACGTCATGCAAGCCGACGTTGCGCCGCTCATCAGCTCGCTGCTCG
GGCTCCCGTACCCTCGGAACTCGGTTGGCGTCTTGCCGTTCACGTACCTCGCTCCAAGTCTGTATCGCACTCGTGCCGTTCTCTCAAACGCCCAGCAGCT
CTATCTGCATGCGCTGCGGAAAGaGCAAGAGAAGGAGTCGCGCACGCTGTTCTTCTTTCGCCCGTACGAGCCATTCCGGAACGAACTGCCTCGCGTGATG
GCACGCATGAAGCAGCAGAaCAGCGAGCACGAGGCGCAACGCGTGATCGCCATCTGCCTCGAgaCGCTCGAATATTtCCAGCGCTATGACTGGGCCTTCC
TCCTCAGCGTCATCGTTGCGGGGTACGTCGGTTGGATCGCCTTCGTGGCCATTGCGTACCTCGCCCCTCTCACACACAAGGACCaCGACTTCCACGCCCT
CCAGACCCTCTACTCCAGCTGCTTGCACGCGCCGTTCATGCTGCTGGCGTTcTCCCTGATTGTGTTTCTCATCCTCGAGAGCTCTCCGTGGACTTACGCC
GTCTACGTGAGCTTCCCTCTGGTCTACTGGAATGCCGTGTGGAGAAATCGCGGCGTGCTGCTCGCTCACTGCCCCTCGCTATCTGCCAcGGgATGGCGTT
TCTGGGCTCAGACAGCGTGGCTCTTGGTCTCTCTTGAGCTCGTGGTGCTGGGCTACAACCACCGCTGGATCTTCGGCCTCGTCTTCCTTCTCCTGGCGCT
GTGGCCAACTCTCGACTCGTCCGTGTCGTCGTCTGCTGCTTCGCGTCGCCACTGGTCCCTGTCGTGTCTGCTCATCGCAATGTTCCCCTTCCTGCCGACT
GAGTACGGGGAGCACACCGCTCTCGTTGTGATCGGTGGACTCGTGGTTGCAGCTGTGTGCCATACGCGTGGACAACCGAACTCGTGGCTTCGTACGGCGC
CTCTTCTTGTGTCTCTCGTCGCTGTCCAGGCCACAATGAGCTACCTCAACGCCAAAACCAAGCCCCTGGTATGGCTCACGCTCTTGAACTGGACGCTCGC
CCTCGTGCCTGCAGCCGCACTGCTCCTGCTCTCGTGGCGTCGGGCGGCCCTCGTCGACGTCGCTCTTGCTCTCGCCCCCGCCTACGTCTTGCTCAGCATC
TCGTACGAAGTCCTCTTCTATGCTGCGCTCTGCCTCGTGCTCTTCAGCTGGCTCGACGTTGAATCCTCCTCCAGTCCCTCGACCGAGTCGTCCACCGTCT
GGCTCGACCTTCGTCGCGCTTTCTTCTTCTTGCTACTCATCAAGATCGCGTTCTTTGGCACGGGCAATGTCGCCAGCATGAGCTCCTTCGAGATCTCGTC
CACGTATCGCTTTGTCACGGTCTTTGCCCCGTTCCTTATGGGGgCgTTGCTGGTCATTAAGATTCTCATCCCGTTCCTCCTCGTGGCCTGCGCCTTCCGT
CTCCTCCTGCCTTCTTCCCAGCAGAGCACACGCTACTTCTTACTGGTTGTCGCCCTCTCCGACGTCTTGGCGCTGCAGTTCCTCTTCCTCGTGCGCAACG
AAGGCTCCTGGAAGGAGATTGGCAACTCTATTTCCATGTTTGGCATCGTAAACGCGCAGATCGTGTTCGTGCCGCTCCTCTTTCTGCTCACAGGCGCGTT
CGTGAGcGACGCGCCTCGTCGAACGCCCAAGACGGAGCTCAAGTCCGCCTGAAGCAGGCCAAGCACAAAGTCTAATAGAAAGAAGCAGTTTGCATTCAGT
TCATATTAGAGCAGCATGGAGCTACTATCGATGTCTAGGAGCTCACAGGGGgCGCGACCTCGGGACCTGGAGGCACAAGCGACGCTGTCGGCTCCACTGG
CGTCACTACCGGGGCTCCGTCCGTCGGGGCTGGCGTCGTGGGCTCAGGCGGCGATGCAGGGGCAGCGACtGCGACGGAGGGAGCACTAGACGGCGATGCG
ACCGCTGCCGTTGGGGCGGCCGTCGACGTTGGcGCCGGCGGAGCTCCACCAGAGCCAGCCATCGTGGGCGCCACGTTCATCTCCTGGATGTTGACGTACG
CCACGATGACTGTGGTGTCGTCGATCACTTGCTCTTCTTTCATCCACCGTCGGTTGGCCTCCATGATGAGCAAGTCGACTGCGACCTTGGGGTCTTTCTG
CGCCATCACAATGTCGATCACTTCCTCATTCGACATGAACTCCCAGAGTCCGTCCGTGGCGATCACGAGACATCGGTCGTTGTCGTCCAGAAGGCGagTG
AAGAACTCGGGCTCCGAGACCACGCCGGCCGTGTGTGCCACGGCGTCGCCCAATGATCGCGACATGGCCAAGCCTGGGACGTCCATGTGCCCGAGCCAGA
CTCGTGGAGGACCATCGATGCCGTCGTCGTACTCGACGGCAAACACTCGACCCCCACTCGCGAGGATGCGGGCTTTCTCCGAGGGATGGTCCGGCTTGTG
GTCCACCGAGACGCCGGCACAGGCGATACGCGGCGAGCCGTCCGCATTCGATCCGATGTAGCCCCTCGTGATGCGCGAGTCCCCGACATTGCCCACAACG
AGGAGGTTCTCTCGGATCACAGCCACCACGGCGGTCGTGCCACTGAACTCGGTGTCGATGGCTGGGTCCCGCAGCACGCCCTTCTCGACGGTCTGCAGCG
ACTCGCTGATGGCCACTTTGATGTGCTCGGCGTCCACGTTGAGGTCGCCTGTGGgTGCGAACTTGGCGTGTTtGAAGATCTCACCGGGGAACTTGTCGCG
GATCGTGATGGAGAC