Description :
From Genome Similarity Track
Location :
Scaffold_118:23566- 25599
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_118-abinit-gene-0.46P-type ATPase (P-ATPase) Superfamily

Sequence
2033 bases(100 bases per row)
GAAAACATCATGCTTCGTGGATGTGGACTTCGCAGTTGCGCGTTCATCGTGGGCTTCGTCATCTTCACTGGAGCGGAAACGAAACTACTCCAGAACTCGC
GGTCTGCTCCGTCCAAGCAGAGCAAGTTGTACCAGACTGCGAACCGATGCATGCTCCTCATCTTCGCCACGATGTTCACGCTGTGCCTTGTCAGTGCAAT
CGTCGCTCTGAGTTGGAGCAAGACGAACAGCGAGCGCGTGTGGTATCTACCGTTTGTCAAGACCAACGATATCGGCGACTTCATCGTCAACTTCTTCACA
TTCCTGATCCTGTACAACAATTTGGTGCCTATTTCGCTATACGTGTCGCTCGATATTATCAAGGTGATCCAGGCGCGCAAGATCACGTTGGACGATGAGA
TGATGGACGACGGGTTCCGTGCGATTTCGAGGACCTCCGATCTCAATGAAGAACTTGGTCAGATTGAGTATGTGTTCAGCGACAAGACGGGCACACTGAC
CCGAAACATCATGGAATTCCGGAAGTGTTCGATTGGTGGCGTGGCGTACGGCTATGGAACAACTGAGATTGGTCGTGCGGTGGCTGCGTTGCAGTCTCAA
GGCGTGGAAGAGACGGATGGAGTATCCACCACCAAAAGCTTAACGAATATCGCTGGCGATCCTGATGCTGCCCAAGTTCATCGCGACCCCTTGATCAACT
TTGACGACCCAAGGCTGCTGCAGCACCTCGCCAGTGACGGAAAGCAGGCAAGTCTGATTCGAGAGTTTCTGACCCTACTCTCGATATGCCACACGGTCAT
CCCTGAAGTTGATCGGACGACGGGGGTCGTGACATATCGCGCATCATCCCCGGATGAGGAAGCCCTCGTGAAGGCCGCCAAATGTCTTGGCTACAATTTC
ACCGAGCCGGCACCAATCACCAAGGTCGAGGTCTCGAAGAAGAACCTCATCACTGGCAAGATTGAGTCGGAGCCAATCACGAAATCGTACACCGTCCTCA
ACGTCAACGAGTTTAACTCTACCAGGAAGCGCATGTCGATCGTGTGTGTCAACGAAAAGGGCGAGTACGTACTCTACTGCAAAGGCGCCGACAACCTGAT
GCTTCCTCGGTCAAAGGCTGACGCGTTTACGGGAGCTGTGAACGATCACTTGAAGACGTTTGCTGGGGAAGGCCTTCGAACGCTTGTGCTCGGTCGTCGG
ATCCTATCTGCTGATGAGTACGCTTCATACAATGCCCAGTATAACGATGCCGCGACGTCACTGGAGGGCCGAGAAGAAAAGCTTGATGCCGCCGCGGAAG
CCATCGAGAAAGACATGGAACTGGTTGGTGTCACAGCCATTGAAGACAAGTTGCAAGTGGGCGTACCGCAAGCAATTCATGACCTCGCTAAAGCGGGCAT
CAAGATTTGGGTCCTCACTGGAGACCGTGAAGAAACTGCCATCAACATCGGTCATGCCTGCAGACTCATCAACGAGAAGATGAAGCTCCTCTATGTCAAC
CAGGAGCGCATTGATGACTTGGAGCGGCAGCTCGATGAGCTGCACGGCTCATCTGGCATCCATCAGCTCATCAAACAGAACCGAGTTGCCGACGAACTTG
CGATGGTGTGCGACGGAAAAGCTCTCATCCACATCTTTCCCTCGAAAGATGCGATCACACATATGGGGCCAGAGGAAGACACCCGTCGTCGAGTGCTTGC
TGCCAAGCTGCTCGATGTTGCGAGTGTGTGCAAAGCTCTGATCGCGTGCCGTGTGAGTCCATCGCAGAAGGCCGACATTGTGAATCTTGTTCGCAAGGGA
ATCGCTTCGAAGCCGATTACGCTGGCGATTGGCGATGGTGCAAATGATGTGAGCATGATTCAGACTGCCCACGTCGGTGTGGGTATCTGCGGGAAGGAAG
GCGTCCAAGCTGTAAATGCCAGTGACTACGCCATCGCGCAATTCCGTTTCCTGAAGCGACTCGTGTTGGTACATGGCCGTTCGAACTACAAGCGCATTTG
CAAGGTCATCCGCTACTCGTTCTACAAGAACAT