Description :
From Genome Similarity Track
Location :
contig_13:235657- 237100
Transcript NameFunction/comments
g2846.t1hypothetical protein

Sequence
1443 bases(100 bases per row)
GCCGACTCGCTCAGCACGATCTGTCCGCCTTGCCCCAACTCGCTCATCTCGCGCGCCATCATCTCGCTGGGCCCCAGGTACGTCATCTTGCCTGTCGTGG
GGTGGCGCGCGCACACCAACCGCTCGTCGCCGTCGTGGATGGCCATGCGCACGCGCAGTCCGTTAAATAACAGCCGCGCCCAGACATCGTACACGCGCGA
GGCGTTGTCGAATTTGAGCAGCGGCGCCGGCCACGCCGCCTTCAACAACTTCTCTTGGACGCTGACGCACCACCCGATGGCGTCGCGCACGCACTGAAAC
GCGAGCTGGAACGAGTCGCCCGCGGTTGTGATCTCGTAGCCTCGGAAGCGAGGCAGCTCTTGGCGGAGTAAGTCGTCGTGGGTCGACTGCGCCTCGGTCA
TCCTCGGTCATCGCCTGGGCGTCGCCGGCCCAAAGCCGACTGGAGCCTTCAATGTCGGTCACGACGAAAATCGGTCGCCGGACAGGCGCTTCCACGATCA
CGTCGAGCGAGTTGAACCCGTCTTGGAAAAAGCCGCCTTCGAGGAGCTGCTCGTAGACTGAAGTTGGCATCAAAGGGCGCAGCGTGCGGTAGCAGCAAGT
GACGCTGATGCCGATCGCGAAGGCTGTGCCTGCGCCGGACAAGTAGTAAGTGATCTGCGTGAGCCCGACCCACTCCATGCTGAGGTCGTCGTCGATGACG
CGCACCAGCACCTCGACGACGCAGGACGGGAACACGAGCACGCAGTACACGATCACGAACGTCTTGATACGCTGGTGCAGCAGCAGCGACGCAGGGTCCA
CCGCTCGCCGCGTCCGCTTCCGACGCGAGATCCATATCGTGACGTACACCGGGTACAGCACGGACGCCCAGATGCAGGCCAACTCGAACCAAAAGGCAGC
GGTCTGCACGCGCTCCGACTTGGTGGACGGCAGGAACGCCGAAACGGCCATCAAAATGGCAAACACCACGGCCGCGATGCACGCGCGCAGGCAATACTGC
CGGATGATGGCGCGCTCGCGCGTGGGTCCGCGGTCCATGGACTTGATGATGAGGCGCTTCATCTCGTACGCTAACGTAGTGATGAAAAAGGTCGTGCACA
GCAGAGCGCAGTCTCCGACCAGCGTGACGGTCACGGCGATGGCCTTGAACTGCTTCCCGTCCGAGTAGACTGCGCGCGCGCCCATGAGCTCGCCATCGTC
GAGCGCGTCCAAGGTGTCTCGCAGTCCGTCGAAATTGACGAGCACGCCCACGTAGAGCAGCAGTCGAGCGAGCGAGTAGACGAAGGACAATCGACACACC
GAGTACGTGATGTACTGCACGGCCGAGTCGCCCACCTTAATGTGCTTGAACGAGAGCAGCAGCGTCGTGGCCGTCGTGGCCGTGGCAATCGCCAACACGA
TCACATACGTCAGAGTCCAGTCGTAGTGGGTCGAGTCATCCAT