Description :
From Genome Similarity Track
Location :
contig_13:235647- 237080
Transcript NameFunction/comments
g2999.t1RAW30194.1 hypothetical protein PC110_g13454 [Phytophthora cactorum

Sequence
1433 bases(100 bases per row)
GCCGACTCGCTCAGCACGATCTGTCCGCCTTGCCCCAACTCGCTCATCTCGCGCGCCATCATCTCGCTGGGCCCCAGGTACGTCATCTTGCCTGTCGTGG
GGTGGCGCGCGCACACCAACCGCTCGTCGCCGTCGTGGATGGCCATGCGCACGCGCAGTCCGTTAAATAACAGCCGCGCCCAGACATCGTACACGCGCGA
GGCGTTGTCGAATTTGAGCAGCGGCGCCGGCCACGCCGCCTTCAACAACTTCTCTTGGACGCTGACGCACCACCCGATGGCGTCGCGCACGCACTGAAAC
GCGAGCTGGAACGAGTCGCCCGCGGTTGTGATCTCGTAGCCTCGGAAGCGAGGCAGCTCTTGGCGGAGTAAGTCGTCGTGGGTCGACTGCGCCTCGGTCA
TCGCCTGGGCGTCGCCGGCCCAAAGCCGACTGGAGCCTTCAATGTCGGTCACGACGAAAATCGGTCGCCGGACAGGCGCTTCCACGATCACGTCGAGCGA
GTTGAACCCGTCTTGGAAAAAGCCGCCTTCGAGGAGCTGCTCGTAGACTGAAGTTGGCATCAAAGGGCGCAGCGTGCGGTAGCAGCAAGTGACGCTGATG
CCGATCGCGAAGGCTGTGCCCGCGCCGGACAAGTAGTAAGTGATCTGCGTGAGCCCGACCCACTCCATGCTGAGGTCGTCGTCGATGACGCGCACCAGCA
CCTCGACGACGCAGGACGGGAACACGAGCACGCAGTACACGATCACGAACGTCTTGATACGCTGGTGCAGCAGCAGCGACGCAGGGTCCACCGCTCGCCG
CGTCCGCTTCCGACGCGAGATCCATATCGTGACGTACACCGGGTACAGCACGGACGCCCAGATGCAGGCCAACTCGAACCAAAAGGCAGCGGTCTGCACG
CGCTCCGACTTGGTGGACGGCAGGAACGCCGAAACGGCCATCAAAATGGCAAACACCACGGCCGCGATGCACGCGCGCAGGCAATACTGCCGGATGATGG
CGCGCTCGCGCGTGGGTCCGCGGTCCATGGACTTGATGATGAGGCGCTTCATCTCGTACGCTAACGTAGTGATGAAAAAGGTCGTGCACAGCAGAGCGCA
GTCTCCGACCAGCGTGACGGTCACGGCGATGGCCTTGAACTGCTTTCCGTCCGAGTAGACTGCGCGCGCGCCCATGAGCTCGCCATCGTCGAGCGCGTCC
AAGGTGTCTCGCAGTCCGTCGAAATTGACGAGCACGCCCACGTAGAGCAGCAGTCGAGCGAGCGAGTAGACGAAGGACAATCGACACACCGAGTACGTGA
TGTACTGCACGGCCGAGTCGCCCACCTTAATGTGCTTGAACGAGAGCAGCAGCGTCGTGGCCGTCGTGGCCGTGGCAATCGCCAACACGATCACATACGT
CAGAGTCCAGTCGTAGTGGGTCGAGTCATCCAT