Description :
From Genome Similarity Track
Location :
Scaffold_203:23562- 25988
Transcript NameFunction/comments
Phyta_totarag5528hypothetical protein PHYSODRAFT_532111

Sequence
2426 bases(100 bases per row)
GCGTAGCGATACAGCTGCCCCAGACTTCCTTCGCCACAATCCAGCATCATGCCCGCCCAAGTGTTGTCCGTCTCATCACCTTCCTTGTCAGTAGGTAGCT
CAAGGTACATGCCTGTGACGTTGCGATACTTTGATGGGATAGCACAGCCCGTGCCGAGGAACGTGATCCGGCCATCGATGAGATCATCGTCCGAGTTCTC
CGCCTCTGAATTCTGGGATACCTTCGCTACGATCTCCGCAGACGCGCTGACACTCTCACGAATTTGGTCAAAATCGAGACGCGGCCAGCAATTTAACGCG
TCAAAGCCACGACGAGCCTGAGGAGCTAGCACAAACTTCAGCATACTCTCGCCCAGAACCACTTTCGATGATGCTGACTCCGAgctctcctcttcttcgc
tttTAGCAGTGAGTTCCAACGAGGAGACATCCGGCACAGCACGCGAAAAGGGCACAACAGTGTCGAGCAGTTCATGCGCCTCGTTAGACGGGAACGCGCG
GGAAAACACTGCATGCAACTGCGCCTGCAACTTGGCAGAAGCGCGGTACACCGTCTTCTGCGCACACGCGCCGTGTGCAAGCAGGACATGGCGTGCTTGA
GCGCCAAAACTCCTTGCCCACTCTGCGTACTTCGGGTggcgcagcacctccacaCCACCAAGATGAAACAGCACTTCTACCTCCACCTCTGCAGGTCTCC
CTTCCCTCTGTCTGTATCGGTTAAACCCTTCACTGCCCACCAATGCATCCACATGCGCCGTCGTAGGACAACTCGCAACCACACACCCTGCAGCAGGCAC
GGACGGCAGCACACAGTCACTCGACGTGACCACCCGACCATCGGACAGCGTCACGTCCTTCCCTTGATGCAGTTGTCCGAACAACTTCCCTTTCGGCACA
cccagcgccagcgcccGATCCACCAAGAACTTGCCTCTCTGCGTCctcgtctccaccacgtaACTCACACTCACGTGGCTGCTCTGCTCCTCGCcttccg
acgacgacggatTCTCATTGAGCTTCCGTTTGGCTCCGGCTCGAGGCTTCGTCACCGCCACCGCCTGTACCAGcacctcgtcatcttcataGCAGCTCTg
tatcttcttcttctgcttcttctgctcaTCGGTGCCAATTGGCAGCACCTCGGAAGCCTCCAATTTGAACTCTGGACGGTACAAGAAGTGGCGAGTGGCA
TTCAGGTACATCTTGGTGTCCGGAGGTCCGTGCACTTGCAACCCAGGCTTGCCCGTGTCCGAGACAGTGAGCACCATACCGGGGAGACCTCCCACTGTGT
GGGACCGCAGCTCGGTCAGGAAAACGCGCTGGAGCTTGGCCAGACGCACGTGGTGCTCCATACACAGGCGTTGTGTGCCATCCCCGACGTTGAATAGGAA
ACTGCGAGCGACAGAGACAACATTTAGAGGAACGGCATTGCCAGGACGTGAGCAGGCGTCTTGGCAACGTACCGACGAGTTTCTGTGGACAGAAGAAGGC
TGGGTGCAGTCTCGATGGACTGCACGCTGAGCACCTGCACTTGCACGACCATATCGAGACTGTTAACGGCTGACTGGCTCAGCAAATGGATAGTTATTAA
AGGTGTTGAACAGAAAGGTTACTTGTTAACAGTGTGTTTGATGGATACTTTTATGAGAGAGCGAGAAATAGTTATGAGTGAGTGAAGTTCTGTTTTGTAT
CCATGAGGACGAacatttttgttgttgaagctggtTACAGTAGTTGCCTTTTTAGTGCCTAACGTAGTCTAGGTGTGCTTCCGAGTCGTGTTGTGGGGGT
GAGTTCTGGAGCGGTTGGAAGATGTTTGAGGGAGCGTTGCTTCTGGAAGCTGAGCACTCGCATGGTCACGGCCTCTTGAGACGGCAGGTCCCCAGACGCG
AGTCTGCCGGAAGGTTCGTCCAGTCCGTTGAACGCGAAGCTACTCCCTGTATCAACAACAGTTAGTCACGTAAGAGTGAGTCATCATGGAGTTACAGCCA
CGTTAACACTgagatcgagatcgagaCGTACGGGCTTGTGGCTGCGGTAGACTTCCTTTGAATGAGTCGTACCGAGGCAggttgttggtgctgccacTTC
GTCGATTCGGAGACGGTGGCTGTCCCGTCACGACGAACGTGGTCGGCTTGCTTGAGCTCTTGCTGTCGCTCTtgttgtcttcgtcggcaGATTGCTCTGC
TTGGAACAGCTTGTCGGCGGACGGGGAGTTGACGTGAGTCGTCGGGGCCACGACGTCACTGACGCGCTTCGACTTGACGGGGCGAAAACGCTCTCGTAGA
ATGTCTTCGGCACTTGGTcggaactgctgctgagctgcgaTGGCTGTGAAATCGATGACCATGGCCGCAATGGGGCACAATAGCAGCAACGTCCAGTAGC
ACTGCTGCCGGATCAGGTGCGCCGGC