Description :
From Genome Similarity Track
Location :
Scaffold_7:23554- 26424
Transcript NameFunction/comments
Phyci_518198predicted protein putative

Sequence
2870 bases(100 bases per row)
CGGCGACTCCGCGCGCCGGTCGCGCCGCTCCGACGGCTTCTCTCGCCGCCGGCGCCGCAGTCCCAGCGCAGAGGACACCTCCACACGCTCGCAAGACGCA
GGAGATGCTCCAGATGTCGAGGTCATCCACGACTTCCGCTCCAAGCGCGCGCTGGAGGCCGCCGAAGACGAGGCCAAGCTAACGCCCGAGGAGCGCGAGC
GGTTGCGCGACCGCGAGGAGCGCGACGCCTTCGCCGAGCGGCTGCGGCAGCGCGACGAGGACCGCACCAAACACAAGCGCAAGGCCGACGAGCTGGAGGC
GTCCGAGGGCGCGGGCGGCCTCACGCGCGACGAGATCAAGCAGCTGGCCACGAGGGGGACAGTGGACGCCGGACAGGACGCGCTGGGCGACAAGCTGCGG
AGGCTGAGGGAGCTCAGCAGACAGGAGTATCTCAAGAAGAGGGAGGAGAAGGAGCTGGAGCTGCTGGAGTTCCAGCTCAAGGACGAGGACGTGCTGTTCG
AGGGCGGCAAGAGGTCCAGGAAGGAGCAGGAGCAGCTGGAGCTCAACAAAAGGATCCTGGAGACGGCCAAGGCCAGGTCCAAGAAGGAGGAGACGGAAGG
CTACCAGATCCCGGATTCCTACGAGGAGGTGGACGATGAAGGCAACAGGGTCAGGAAGAAGGAGGACTTGCTGACGGACAGGTACGAGGAGGAGGAGGTC
TTCCACACAGAGCAGGAGGTGTGGGAGGAGACGCAGGTCAAGATGGCTACGAGTAGGTTCGGGGCCAAGGACAAGCGCAAGAAGAAGACGGAGGAGGAGG
ACGAGCTGGTCTTCGACGACCAGATCGACTTCATCTCCCAGCAGATGCTGTCGGGACATCATGTGAGTGACGAAGATGTCAAGGAAGCTAGGAAGAAAAT
GGAGGAGGCCAAGCATCTGAGCATCCAGGAAGGAAGAAAACAGCTGCCGGTGTTTCCCTATCGTGAGTCTCTCCTGGAGGCGATTCGGAACTACCCTGTC
ATTATCATTGAAGGAGAGACGGGATCGGGCAAAACGACGCAGATCCCGCAGTACCTGCATGAGGTTGGGTACTCGGAGCTGGGCACTATTGGCTGTACGC
AGCCGAGACGAGTTGCTGCGATGAGTGTGGCTGCGCGTGTGGCGCAGGAAATGGATGTGAAGCTGGGTAATGAGGTGGGGTACTCGATTCGTTTCGAGGA
CTGCACTAGTGACAAGACTGTGATCAAGTACATGACGGATGGTATGCTGCTGCGCGAGTTCTTGACGGAGCCAGATTTGAAGTCGTACAGTGTCATGATT
ATTGACGAAGCACACGAACGGACACTGAGCACAGACATTTTGTTCGGCCTCATCAAGGATATTGCGCGTTTCCGTGACGATATCAAGATCATTGTGGCTA
GTGCAACGCTAGATGCGACCAAGTTCAGCGCCTACTTCGATGATGCCCCGATCTTTAAGATCCCCGGACGCATGTTTCCCGTTGATATTCTGTACACAAA
AGCTCCCGAGGCTGACTACCTGGATGCGGCTATTGTGACAGTCCTCCAAATCCACATTACTCAGCCCCTTGGAGACATTCTCGTCTTCTTTACTGGTCAA
GAAGAAATTGAAGCAGCCGAAGAAATACTGCTGCAGCGCACGCGCGGCCTTGGCTCTCGAATACGCGAACTGCTCATTCGACCGATTTACGCTACTTTGC
CCTCGGAGCGCCAGGCTCAAGTGTTTGAGCCAACGCCAGAGGGAGCTCGCAAGGTCGTGCTGAGTACAAATATTGCAGAGACGTCGTTGACCATCGCAGG
CATCTGTTTTGTGATCGACACGGGCTTCTGCAAGCAGACCAACTACAACGCGCAAACTGGCATGGAGTCTCTTCTGGTGGCACCAGTGTCACAGGCTATG
GCGAACCAACGTGCTGGTCGTGCAGGTCGTACAGCTCCAGGGAAATGCTTCCGCCTGTACACTGCGTGGTCGTACAAGAACGAACTAGACGAGAACACTG
TACCCGAAATTCAGCGCACGAACCTTGCTAGTGTTGTGCTGCTGATGAAGTCGCTGGGTATCAACGACCTGCTTCATTTCGACTTTATGGATCCTCCGCC
AGAGAAGGCACTCATTCGCTCCCTTGAGCAACTGTACGCTCTTGGAGCTCTGAATGGTCTGGGTGAACTCACAAAGCTGGGTCGGCGAATGGCTGAGTTC
CCGTTGGATCCCATGATGTCGAAGGCACTGCTCGCATCAGAGAAGTTTGGTTGTACTGAAGAAGTGATGACAATCTGTGCCATGCTGAGTGTCAACAACT
CTATCTTTTACCGCCCGAAGGACAAAGCTGTGCACGCTGATAATGCTCGACTAAATTTCGCGCGCGGCGGCGGCGGTGATCACATCACATTAATGAATGT
CTACAACCAGTGGGTCGAGACGAACTACTCAACGCAGTGGACCTACGAGAACTTTGTGATCATGCGCTCGCTGAAGACCGCACGTGATGTTCGAGAGCAG
CTTGAAGGCCTTTGCGATCGCGTGGAGCTGGAGCGTACGAGCAACCGTAGTGATCACGAACCGATCCGCAAGGCCATATGTGCCGGCTACTTCTACAATA
CCGCCAAGCTGGACAACTCGGGTCACTACAAGACGGTCAAGAAGGCGCAGTCCGTGTACATCCACCCAAGCTCGTGCCTAATCAAGCTGGAAGAAGTCCC
GCGCTGGGTCGTGTACCACGAGCTAGCCTTCACGACGAAGGAGTATATGCGCAACGTGATCCCCATCAAGTCCGATTGGTTGATGGAGCTCGCGCCGCAT
TATTATAAAACCAAGGAGGTTGAGGATGCTCGCACGAAGAAGATGCCCAAGGCGGTAGGCCGGGCTGGTT