Description :
From Genome Similarity Track
Location :
Scaffold_363:23544- 25463
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh-pir_contig_363-abinit-gene-0.62FUN14 family protein

Sequence
1919 bases(100 bases per row)
AGCGACGGCGGCGACAAGAGAAAGAAGGATGACGACTACGTCAACTGGCTCATCGACCAGTTCACAAGCCGTCTTGGCGATATTACGCTCGGCAGTGGTC
TCGGCTTCTGCTCGGGCTACGCGCTGAAGCAGGTCGGCAAGGTCGCCGCGGTCACGATCGGCGCGCTCTTCGTGCTCGCGCAGGTCGCGTCGTCGAAGGG
CTACATCGACATCAACTGGAAGAAAGTCGAGAAGGACGTGATCACGGCGGTGGATCCGGACGGCGACGGCAAGATCACCAAGAAGGACTTCAAGATCTGG
TTCGACCGTCTCGTCGCCACGCTCAAGTACAACCTGCCATCGTCCGCAGGCTTCACTGGCGGCTTCGTGCTCGGTCTCTCGTGCTCGTAAGTTTTTTTCT
TTGTTCTCTTTTATTTTTTGAAGTGCATGCATGATGCTCAGCATTAGCATTAGCATCAGCACAGCATTCCACAGATCGACTCCGCTTAATCGAGATCATA
GCAGTTTGATTGCCACCGTAACATCATAATTGCACTACTTACCATATTTGAAACCTCATCGTTGTTGTGCTGTTTGTTCTTCATCACCACGATCTCCATT
TTCTAAATTACACAAAACCAAATGAAGAGTCATCATCAGCGTTCATTCCGACGGGAACGCTCGCGCGAGGAAGCCGACGATGACCGTGCGGTCCTCGGCG
CTCACACCCATGGTCTTGAGGTCGCGCGAGAACGCCGGTACGCTGCTGATGCCGTTGCTGATGAGGTTGAGCCCGAGCGTCGAGTAGAGGATCACCTCGG
GGCTCTCGAAGGCGAAGTACATCTGCTTGCAGCTCTCCGAGCACATCGGGAAGCAGTCCTGCCACATCTTCTCGCGGATGCGCAGCTGGGATCCACCGTC
CGGGTCCTATTTGTTGTGTTTGTTGCCGCAATCACACATCATGAAGCAACAAATGAATACACAGGCGTGAGAAAGACACGCAGCTACACTGGGGATGGAT
GGATGGGTACACAGGAGGAGGTGGATGGGACGCTCACACTGACTGGCGCCACTTCTCCAGTATCACCGCCTTGGGACTGCTGTTCATCACAGAAACAGAG
AGAGTGTGTGTAAGGAGCCAATCACTCACCAAGCTTCTGATGCATAACATACCGCTATCAGCGCCTGTGTGCGGAGACTCAGTCCGCTCGCCGAGAGGTT
CATTTCCTAAATCAAGCATGAAGAAGGGCGTTAGACCCATTGCGCTCCACATTGAGTGCACGCAAGGGACACACGCAGAAAGAGAGCGCGTATCTCCACC
CTCACAGTCGCGTCCTTCTCGATGTAGATCTTGTACGCCTCGGCAGTCGAAAGTCGGATCCCAAAGAGCGTCGCTTTCCACTCCTTCAGTCATGCGCACA
TATCATCGCCAGATCAAACACTTTTGTAAGCGACCAATACGTGTAGCTCTTGAAAAGCAGAGCAGAGCAAAGCAGTACGCCGCCTTCCGCAAACGTACAC
ACCTCAGTCTCGTCTTCGTCGTAATCAAACTCGATCGGCGAGAGCCACTCACGCTCCACGAGGCGGTCCAAGATCCGCTGCGCGAGAGCGTAGCGCGGCT
GGTCTTCCACCATGACACCCGACGCGCTCAGATCTAATGGCGGTGGCGGCACGCCGTCACCACCTGCTGAACTGCTGTCGCCAAGCTGCTCGTCACCGCT
GCTGCTGCAGCTGCAGCTGCTGGTACCATCGTCTCCTCTGTTGTTGTTGCTGCTGCTGCTGCTGTTCTGGAAGAGGAACTTGGCGCCGAAGAGCTCGATG
CCCTCGCGCACGAGCCAGCCGAGCAGCAGATTCTTCTCGAGGAACTCCTGGCCGCCGTCGTCCGACACCTCCGTGATCCCCGCGTGCTCGAGCAGCACGA
CGAACTCGTCTTCGCTCAT