Description :
From Genome Similarity Track
Location :
Scaffold_29:235391- 237634
Sequence
2243 bases(100 bases per row)
actcctcctccgctaccagggtctttgcctgcgcccgcagctgcagaagccacatcggccacctctggttggaccatcttgacttgccttgataaaagcc
gaaatggaagagcaacggtttcgacctctatcggaaataggtgagctgtaaaaaaataataaattacaatcgcggaccaaacatgttttgaaatcatgtc
tttccatgattgaaatcatagcctccaacggttccgTTTTTTTTGTGGTGCTGGTAGCGGTGGGGGGAAGTACGTTGTTAGTAgtaatgcttagaatatt
acctcggcgttttttttaaccgtaatttaccaacaagaacgatcctggaacgttctacaccaacatacacttttccttagatacaaccgctaaccaccct
ctggtgcgaaggaggcctcctccacacctccgagcaacacagatagcaacaatAACTATactagccgatcgccgccgcttcgcggcggtgggtgtgtggt
cagtcataggcggttacgctcgctgttccagctcgctccactatttgtcatagccccctccgcatcgttccggcgggtctacagttcggcgcaacccgtt
acgctacttggcataccgttcgtctcaacccattacgctcgctgcgccagctcgctccactaattgtcataccgtttgtcacaacccgttacattcgctg
ttcctgctcgctccactactgcgcgatcgcgctcgGtgcttgaaggtccgccatgggtgaaggtcctgtgggaggtgcttgaaggtccgggtttacccct
gtccagcgcacgtcttgtatttcgcgcgttgtgtcgcgaaatgtatctagcaccccgaatagcagtatattataacggagagagttttgcccaatcacat
agcagtgataatatattatgtatttatccagtcaacgcttaggtccagaaattcgtcgtctattaactttagggcgtatgtataggttgctgtgttgcac
accgtcgctgtgcggcgctcacgtcctgtggggcatgctgtggcgcccgccgttcgcgcgctacgtcgctccgccaagccaggaattcaaaaacagaaaa
gcaaacgctaagccgaaaaacgtccaatcatagagcgttataaatataacgtaagaccatttttgtaatatcgggcaaagataagacaggcaagaggatg
gtgagatgctatagggtaggttagtaataggcggcccggacaacccccagacgatgctgtagggtaggctgatgccgcaagggcggggacaaacgaacag
tggacaaacttacaggatactcggttagttgtaggggaTAAGTAATAGAGGCTCGTATCACACAAAGTCGATTGATCTGATGAAAAAAAATACCATTAGC
ttagagcagctaataacttgggctcttctcattaacaaagtcattcttctttagccaatcgatgtatccacaatcgaatgaatagatctgttggatagtc
ttccctttgtgcgttccccacgtcattaggaacgacccgtcatcatTAGTGAATTTGCTCTTATAaactcagcaatcgcagggttcgaatcaattagaat
cttttgattcagcagccaacgacagtagcctggatcagaaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN