Description :
From Genome Similarity Track
Location :
Scaffold_337:23539- 29607
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_337-snap-gene-0.12TBC1 domain family, member 7, partial
Pytir_DAOMBR486maker-pir_contig_337-snap-gene-0.19Nipped-B

Sequence
6068 bases(100 bases per row)
TTGTGTTTTTTCGCTACCTGCAATGGCGCTGAGCCGCAACTTCCGCACGACGTACTACAAGACGCTGGGCGTACCCGTGGTGCAGCACATCGTGGACGTC
GAGGCGTCGTTCGCGGCGCTGCTTGCCGAGCCCGTGGTCAACCGCGCACAGGTCGTGAAGCTCGCGCAGGAGATCGGCATCCCCGCGCACTACCGCGACT
TGGTCTGGCAGCTGCTCAGTGGCGTGCTGCCGCCACAGACATCCATCTGGGAGTTCGCGATCCGGGAGCGCACGGTGATGTACCAGGACGTGGTGGACGC
TGCGCAGGTACTGCAGCCTTCTATAGCGAGCGACGCGAGAATCGAAGACGGAGATCCTGGCTGTTACGAGAATGCTGCAGATATTCATGTAGACGTGGCG
GATCGAGATGTGGATGTGGCGGACGCTTCGAAAACTACAAGCCAGTCATCTTCATCCTCATCTTCATCGAACGCCAACGCAAAGACGACGTCCAAGCACG
CTCTCTCGCGTCTGATTCGGCTGCATCGAACGTACTGGTGCGAGATCATGGTGCGGAAACCGCTGCGAGGCATGGACGACGAACTGTATTTGGAAGGTGT
AGCATGCATGGTGTGCGAGGTTGTTGCAGGTGAGATGGAGCGGTTCTGGTGCTTCACGAAGCTGCTCGAGCTTTTCCACGACGGCATGGGGCAATACAAG
CCTACGGTATCGCTGCAGAATTTCCACGACGTAAGCAGTGTGTCTGACTTTGAAGTGCTCTTCATTCGCATCTTGGAGGCTCTAAAGTAAGGCATGGATG
GAATCGTAAAACTGCGTGCAAAAATCTACGCTACTGGGAACGGCCAACTAGAGTTGCTGAAAATTGCTAGCCCGCGAACCCTTCGACAATTTCATTGTCG
TCATCGTCTTCAACGCCAGCTCTGTGCTTCGCCTGAACGGATTTGCGGCGTCTTCCTTTCGTCTTTCGAAGTTTGCCAGCGGCATCCTCTTGCACCTCGA
AGTCCATCTGGTGCTGGTCATCGCGCGCTGCCTCCCACATGCTAAGGAACAGCCTCCAGCTCAGCTCTACAGGGTTTTCTGTCTGCGCGATGTCAGACAG
AGATGGGAGACGCAGCCTCGACGCGCGATCGGAGGACAACATGGCAGGGTGGTCCGTTGCCTACAAATCGAATCAAGAGTTCTGTGAGCTTACATAATAT
TACAGAGATGCACGAATAATAAACACATCATACCTTGGACGAGTTTGTTGGCTGGTAGGTTATGCATTTCTCGTTGTCGAGAAGATGCATCTCCTTCAAG
AAGAACTTTGCGCGGATCAGCAAACTGATCGCAAACCCCGCCACGCACTCTTCTTGGAGAGTTCTCGCTTCACAGTCAGAAAGGTGCACGGCAGGGAGAT
AGTCCACGACATCGACCTCCGAGAAATCCGTATCCTCATCTGCCATGATATCTGGTGCGAGACCAGCATTCGCAAAGAGCTCCTTCACGCCGTCAAGAGT
TGTGCTGCATCATCAACACGAAAAACTACGTTAGACAGAGGATGTACAAGGAAAAGGAATACGTGGCAGAATATGCAACTCACCCGAGCTTGAGCGTGAC
GTAGCGGTTGATCAGATAAATAATATACAGAGGCTCGTCTTCGACCTCGTACGGCAGTGCACAAAGCAGTTGCGCCAAGTAGCATAAATAGTTGATCGTG
TCCTTCAACGCCATCGACGAGCTTGCTCTTGTAGTTCCAGCCGTGGACAAGATACCACCCGAGTCTGCAAACTGGTTCACGAGTGCCTTCAGAAACAGGT
TCCGATGCATCCTTCCTGCACGAATGCAGTCCGAATACAGCCGTCCGAAGAGACAGTACTCGCGCTTATCCTTGTCCAACGTGTATACCGAGCAGCTCCC
GAACGCGCTCAGCTGAAAAGAATACGATATCTGGATGCCTTGAAGCGAAGGCGTGTTCAGCAGAGTTGGAAACTTGTCGTTTAGAGCCACCAGTTGGCTG
TGAGCCAAATCTCGAATCAGAACCACTTGGTCAGTTTCCAGGGCAACCAGGTTCGGGATGCAGTGGAGTGGGCTGACGAGTCCCTGGGTCAACAGAGTGT
CGATGCAGACGATCGCCTCAGTGCGGATGCGAACCGGCTTCGCCAGTGACAGCGCCAAGATATTCTGGATTTGAGCTTGCATCACACTGCCAATCAGCGC
TGCATCAGCCTCTTGGTCTCCTTGAACTTGCTCCTTCTTGCTTTTCGCGTTGTTCATTGTCTTTGTCGCAGAGCCCTGCTCCAGCCGTCGCTCTTCGAAC
TTCAGCAGCTCTGTCAGACTTGTCAGACACTGTAACTTCATCTCATCTCCCGAGTTATACAACATGAAGTCCAAAATCCCATCTTGTTGTGCTTGAAGGA
GGAGTCGGGTGCGGGTGAGAAATAGAAACCCAAGTCCTTGGGCAGCTTTGGCAGCGCATGTTGGATTTCCTTTCATGTTCAGAAAGCGAACAAAAGTATC
ATAGAGAGAGTCCATGATGGCCCCTTTCTTGAGATGTGCCAATTCGTTGTCTGGGATCACGCAAGCGTCCAGATCAATCGCACCACCGACTTGACCAGCT
GTGAAGAGTGCTCGCTGCAGAGACGAACTTACGTCGGTTGGGATGCTGGCTAGTGAGTCAAGGTCTTTGCACTTCAGCAGGTAGGAGTAGAATGTTTCCA
GGAGCTTGACCAGGAGAATTGGAGGTTTCCTGGTTGTCGTGGCAATCGTGGCGAGACACTTGATACTTGGACCTACAACGCTTGGCGGCGCGCGGAACAT
CAACGACTTCACATCGCCCTCCAGTCGTTTCACAAGCCTCTCAGGAATCCGCTCCATTTGCGCAAAGACGTTGTTGATCATGGAAAGCACCAAGCTTTGC
ACTTTGTTCTCGACTGCCTTTGCCAGGCTGTCATCGCCTTTCAAGTGGATCATAATTAGCTCCAAATGAGGGTACATGAGTAATGGCCGAGCCTCACAAA
ATGCTGACAACGTCTTCATGCACGCGAGGAACTGCATCTGCTCGTCTCCGATAGTGACTCCCTTCAGCGGCGTTCCTTCTTCCAACTGCAAGAGGCACTC
CACAAGATATTCGACGATCTTTTCAGAGCGTACTTTCGCAATCTTGACCTCGTCAGATCGATCTCTGTTGAATCGTGTACCGCCATTTGCAGCTTTTTCT
CGGTCGTCCTCTTGCAGCAAACGCTTCAAAAGGGCAACAAACCAGTCCAGGCTCGACATGTCGTGGATCACTTCGACAATGGTAATGACCATTTCAGGGG
TGTCGTCGAGCTTCGATTGTTTGCTCTTGACAACACTGGAGGGTGTGACTTGAGGAGTGCGATATACTGACCATGCTTCATCGAGCGAGCAGAAAGCCTT
GCCGTCTGGGGAGAGAAACTCGACTTTTTTACTTCGTGTTGACTGAGGTTCGCCGTCATCCTTCCCAGGATTGGTCTCGACGGTTTTCCATCCTGGCGGC
AAATCCGCTACAGCGCTTTCTTCTGCAAATTCGCCCGCAGCAGAGGACAGCTGTCGAGAAGAGAATTCTGATCCGAACCAAACCTCCTGAAACGTGTCAA
TGATGAAGTTCTTCATGACCAGCTCCTCCGATGGATCTCCAATACGCTCAACCAAGCTGCGCATGCATGCACTCTTGCGTCGCAGGTCTCCTTCCGCAGG
GATGCCGTCCTCTCCATTTTCGTGAGATGACGAAGTCAGGAATGTGCGGAAGATTTTGCACACGCTTTTTCGAACACTGATGCCTTTATCACGTAGACGT
TCCGCCAGCATATCGAAGTATCGGTCAAACTGCAGCATCAACACACAAAAGTTAATTAGCACCCTAGGGCATGTAAAGAATACACCAGAAAGAAAAACTC
ACCAAGAGAGGCTGTAGTGCCACATGCCGACCAACTAGATCCACCGCAGCTTGCCGAACTGAAGTGCCTTCATCCATAAAGCACCGATTCACGGCGGCGC
GAACTCCGCCATCAACCATCAGCATCGGGTCGACGTCGACCACTCCCGCGAGAATCTTCAACACTCTTGCTCGAAATGTTGGAATGCCTCTTGATAAAAG
CGACATCACGTGTGCAAGAAGCTTGTCAAACAAGCAACAGAACTCACGGGTTACGACCAGATGCAAGCTCAGTCTCTGCACGTAGTTGCTCGACGGGGAT
AGCAACTTTGACGTGGAATCAACGCTTCGAGGGCTGTTTTGCCAGAAGGATTTCCAGAGTGAACTCTCAAAATCTCGACTCGACTTGAGCTCAAAACCCG
GACAGGAATCAGCAATAAACCTCGCCAAGAGTAGCCGCCGCGAGTCGTCTTGAGCAATATTCACGCGATTGCCTCTTCTCGTAGACACCATGAGGACATG
CTTCAAGATCACATTGTTTTTAATCAAGTCTTGCTGTGAAGGTCCATCTTCACACTTGGTGGCGACAAAGTTTTCTCTCAAAAACCTCTCATGGTCCTCG
AGGACCAAGCGGGCATCAACGTCTTCTTCAAGCACATCACGCGCAGCCGTGTTCTGGTACATCTTGATGGACGTGCAAATTTTGCCGATGAGGTTGAGTG
CGGCCAGGGTGTGCTGTGACTCCAGTTTTTTCGCGTCCTTCGCCATGCTCGAATGCAAAATACTGGCAAGTGATGAGCTGAGAACCTCGAGCAGAATTTC
AGCACCCGCCCACTCTGGTCGAACGAACATCACGAGTAGATCTTCCACGAAATTCTCCAATACCACTCGATAGTCACGCTCCTCATGCTTTTTTAAGCAC
TCTTTCATCAATGCCCGGATGAAAATACCCGCATTCTGGCGAGTATCCTCCACCCGTCTTTGAAACTCTTTGGCTTCAGAATCAGGGTCTTCTCCTGCTG
GCATCAATGTTCGCTCGCTTGCTTCAGATCTGCTGGCGTTTTCTTTCTCAATATCCCATATTGAGGAACTCGACTGCACCAAAGCAACCACTAGCGTCGT
GACCATTTGAATATTGCTACTGGAGTCCAACAGCTTGACAGTTCGCAAGTGACGCTTGGAAGTCGGCAATTTCTTCATCACTCCGACAATTTCTTCCAGA
ATTAGCGAGCGATGCGGCTCGTACTGAAGAAAAACCCCGCGTAAGACTGCCATCGCACTCTGTTGCAACGAGGTTGCGTGCACGCTGTGCTCCAGCAAAA
ACAGCTCCACCATGGAGGACGAGAAGTGCAGAATCCATCGATCGGCGAGCTTCACCGTGAGAACCAGTTTCGAAAGCTGTTCAATGAACTCGCACGCAAC
GTTGACCAACGGCGCCATTGCACTTCGGATTTCTCGGTTCGTTCTGATGTTGAAGCTCGCCGAGCTTCTTCGGTTGTGATATCTCGCTCTGGACTTAGGT
GAGGAAGCGTGACTTTCTGCTTCGTGTGCTAAGTCGTTTTTGTCTTCAGCAGGAACAGCTGATGCAGCGGCAGCCGAATCGATGCAGGGTACGATCAAGC
GCTGGACGACATGATTAAACAGCTGAATGCAGTTATCGATCGTCTCTTCTGAAAGCACTCTTCGGTCGATCTCGCGTGTGGATAAAATCAACAGCTCGCA
AACGCTGACATCTAAGCAGAGTTGCATCCGCGAAATCAGGCGAGCGTTGATGCCAGAAGCTTTCCATTCTTCGTCACCGCAGCTGAGTGTCATCGTTCCA
AGAATGTCCAGTCCGATGCCGCGAAGCACCTGTCGAACACAAGAAATTAGTGCACAATTAGCTACAATGCGTGCCAACACCCCAAAAACCAATGCTCAAT
GCGTCAATGAGAACGTACTTGCTTATCGAGAGACCCCATGAGCGTGATTAACAAGTCCAAGTCAACTTTTCCAATCATGTCGCGTTTGCGCATGATCTTT
AAAGTCTGGAGCAACGCTCTGACTTCTGCGTGCGTTAACAAATCAATTCCGTCCCGCTGGAAAGCTCCGCTCTGTTGTCGATAGTGCAACTGATCCAGCA
ACTGGATAAACTGGTCAGAATACTTCTCGACGGTTCCAGCAACACGCTCTTCACTAGTGAACAATGTC