Description :
From Genome Similarity Track
Location :
Scaffold_22:235333- 240522
Sequence
5189 bases(100 bases per row)
CTTCCTCTGACGCTAAAGTTACGGCAGTCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AATACCCCGTGTTCGCGAATTTACCAGGGTGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGAGCGCGGCTCATCTTGCATCGCAAGGTCCAGAGG
CGGTTACACCCAGGATGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCACGCTCAAGAGAAGATGAGCGTCGCAACGGCGGCGGCGTCGATGAC
GCGTGAAGAGTCCTTGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTCCTCTTGATCCGTGAGATCGAG
ATGGCCATGGGATTGGCCCTGCTCCAGTCTGAGCATCAGCGAGTGGCGCTGGCTATCTCCAGGATTGGAGGTCGCGCTCGCGATTGGGCACTAACGTGCG
GCACGTCTGTTGACGCTGCAGTTCCCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTCGCGCGCCGCCTAATCAGGCGTACCGTATCCGGTCGA
AGTTCCTTGCTATCCGCCAGGGTAAAAAGGATCTATTGGACTATGTCCAAGAGTTGAGAGCTCTTATCGCCGGAATGGCGGCGGACCCTCTTCCAGAACT
GGTCAGCGTGACCGTGTTTATGGAGGGACTTCGTGTGAGCGCAGATCGAACGGAAGTGTTTCATGTACACCCTAACTCTTTCGAAGAGGCGGTGGATGTG
ACATTGAATGCCGAGCACAACTTCAGGTCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCGAGCTCTTCGAGCGGTCCAGAGCCGATGGACCTCAGCTATA
CTAAAGATGAGGAAGCGGAGCTTCTCGCTGCGGAGCAGCGTGTCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGGCATATTGCCC
TCTGCGCAAGAAGCACGGGGCTCCGGCGAGCCAACCCCCCGGGTCATCGCCGAGAAACGGCAACTCTTAGTAGGCGCGGGGCGGCCTACTGGGGAAGAAC
TGAGTTCTGTTGTGCCTCGAAGAGGTAGAGGGCAACGAGGCCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGCCGGGCTTGCTG
GTCGTTCAAGCAAACGTGAAGGGCTTTACAAAGCCATGGAGAGTCTTAATTGACTCGGGAGCCTCGGGAAACTACGCCCGTCGCCCCACCCTGGAAGGGA
GTCAGCTGTATGCTGAGGCACTAGAAGTGCTAACAAGAGATACGATTTCTGTCCGTCTCGCGACGGGGGCACTGGTAACTGTGTCGAAGGTCTCTGTCGA
CCTTGGAGTGAAGTTTGAGAGCTTCGAAAGCGTGGAACGCGGTTTGGCCTTAGACCTGGATGCGAGGTGTGACCTCATCCTTGGCCTGGCATGGCTGGAC
CGCCACGATCCATGGATCGACTGGAAGTCGAAAACGCTTGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGA
AGCAGAAGCGCTTTTGGCGCGAACACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGCTAGCAACGAGGTGGCTGCTTGCCCTGA
GGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAACGGGGAGTGGCGCGTAAT
CCACTGAGTGGTACGAGTCTGGTCGATGACCTACCGCTGCGGGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGCAGCCCAGGAGATG
CAGGTGAAGTGACACCTAGTGTACTGTGTGAAGGTCAAGAACCTCTTGGCTTTCAGCCAAGTGTCTTGCGAGACACTGTATCCTCTTCGAGGAGTGATGG
TGCTGCTGCACCCGGGAGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGACGCAGGGCATCTGTG
ACGTCTTCGACGTCGGACGATGTGTCCAGCGTGTCGAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTCGTTAACGGAGTGACGGGGG
AGGTAGAAGACGATATCAGCCTTGACACTCCGTCCGCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTAAAGGC
AGGCGAGCTAGCCGAGGTGGTCCTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTG
AGCGCAAGAAGTGGATCGGCGAACCTTAAAAATCCGTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGCTGTCTCGAAAGACCCACCGACGG
GCCTGCCTCCGGATCGAGGAGTGTGTCATGAGATTGACCTAGTTCTTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGATAGAGCAGTGTGA
CGGCATTGACGCATTCTTCCGTGCAAAGCACGAGGCAGGGATGGTGTGAGAGAGTAAGTCTCCGCACTCGACACCCATGGTCTGTGTCAGAAAGCCGAAC
GGCAAGTGGCGCATTGTTCATGCTTTTAATAAGCTAAATGCGCCCACTATCCCGGCGCAAACGTCGATTTTTCGCAAGGATGTTCTACAGAACAACATGG
TAGGCTGTACGTTGTACAGCGCGCTCGACTTGGTCGATGGTTACTACCAATTGCTCTTGAGAGCGAGCGACATCCGCTGACAGCGGTGAGTACTCCGAGC
GGTATGCTCTGGGAGTGGCCGGTCATGCCCCAGGGGCTGCCGAACGCACCAGCAACGCTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCACCGGGCGT
ACGCTCAGACGTACTTTGACGATATATTCGTCCATAGTCGTGTCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGA
GGGCCTGCGCACTAATAAGGTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTA
CGGGCAGATCCTGGCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCGTAGCCAATTACTTGCACA
CGTACAGTGCGAACTACGCGGAGAGGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGA
GGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCCAATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTATGCAATCGGT
TGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATTGCGTTTGAGTCTCGCCAGCTCAAAGTTGCAGAGAAGAGCTATTCAGTTCATGACA
AAGCGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGTTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGCTACGCAC
TGCGACACAGTCGCCTCATCTCTCTCAGAGAATGTCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAAT
GTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAATTAGCACATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCAGAGCGTATGCAC
AGGAAGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGGTTAAAGACTCTGACAAGGAATTGTCTGCGCGCTTACGCGCGAGGCTGCATCG
ATACTCGCTCGATGGTAGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGCAGTCGATGGGGACCTAAAGTATCGAATCCTCTATGAGGTT
CATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCAATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCT
ATGTACGCACGTGTGAGACGTGTCAAGGGACAAAGTCCGCGCCTAGCACGGCCGCGACATTGGCGAGTTTGCCTGTCCCCAAGGGATGTTGGCAGTCCAT
GAGTATGGACTTTGTGTTTGGCCTTCCCAAGGATAAGGCGGGAAACACGGGTATTGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCG
GTGCCGGACACCATTGATGGTGAGGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCCGATCGAGATC
CGCACTTCACCGCGAGGTTCTGGACGTCCCTCTTCAAAGTGCTCGGCACTCGTTTGGACATGTCCACAGCGGACCATCCGCAGACCGACGGTCAAACCGA
ACGCGTGAATCGCGCTGTGGAGGATATCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAAT
AATGCAGTGCACGCCTCGACAAGCTACACTCCGTTCTATGTGAACGGCTTGGCTAGCCCTCGCGTCCCACTGAAGCCGCCACGCCGTGGCTCAGGGCTTG
ATGGGGGAGGGATAGCCGAGCGACTAGCTGATGTCATCCCTGTTGCGGTTCGCAAGCAAGTCGATGACTTTGTCTAATTGAGACTGAGCGTAATGCGTCA
AGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAGAAGGAACATGCAGATGCTAAGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGTGACCACGTT
TTATTAAACGCTAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTCAAGACGAAGTTAAGACCTCGGTTTATAGGACCGTTCAAGGTCGTGGCCAGGA
AGGGCCTAGCGTATACGCTCAACCTTCCAAAGAAGATGCGCACGCATCCGGTCTTCTATGTTGGCTTGCTTAAGCCATATCAAGACCCT