Description :
From Genome Similarity Track
Location :
Scaffold_437:2353- 5974
Transcript NameFunction/comments
Phyag_g5695Di-N-acetylchitobiase, putative
Phyag_g5696hypothetical protein

Sequence
3621 bases(100 bases per row)
GGCGCCGAGTAGTCCAGCGTGTCGGCGTTCCACATGCCCACGCCACGCAGTCCGAGCTCCCGGACGAGCGCGCACTTGGCCTGGAGACTGCGCGGGTTGT
CGAACCAAatctgcgactgctgcgccTCCCTCACGAACGgggtctgcgtcgtctcgtCCCATTGCTCGCTGAGCCCTTGGCGCTTCACTAGTCGCCGGAT
GTCTCCGTAGTCGATCTGTCCACCGGCCGCATCACTGCAAGGGGCGCCGAAGAAGGGCACTGGTCGGATCTGGCACCTCGAGGCGTCCTCAATTGCCCGT
TGCTGTTCTAGACACGGGTAGCGGTAGCCATACCACGGCACCCCAAGCACTAACTTGTCCGATGCGATGTCGTACGCGAGCAGGAACTCTTCCAGTCCTT
GCCTcacgagcgccagcggcGAGTTGGCGCCAGCTACGCACGCGTCGTACACTTGGCTGCGCATGTCGTACGACATAACAAACAGAAAATCCGCGGCGGC
CGCGAGCTCGCGCCACGGGTAGTAGCGGCCATCGATGCCACGAGGGGCCCAGGGAACGTCGAACGTGACCTACATATATGGCTGTCAATGGGGTCACGAC
AAAGTCGGTtgcgaagagcagcaagaataCGATACCTGCGCGTTCTTGGTGAGTGcgtgctgctccagttcgtGCCGCAACTCGTGTACGAGCAAGCCGA
GACACGTTGACGTGGATCCGTGCATAGGCTTCTCCGTGTCAATGTTAACGCCGTCAGCGTAGTTCTCCACGATTTTCGAGTACGTCGTCTTGGGGCAGAG
CAAAGAAGCGGTAATTTAGTGAACGATTCGCTACCAGGTATCATAGTGTGTCACCGTCGATCCTACCTTGATCCAGTCCTGACGCGCTTTGACGTCGCAC
AGTTGGTCCACATTGTCAAAGTTGTGCTTTACCACAACCTTCACGCCTTTACTGTGTGCGTGGCAGAGCAGCTCTTTGTCCTCATTCCAGGCTACCGTGG
TGAGCTGGTCCCAGTCGTAGTGCTTCCACCGGTCATCCGCCGCCACCGAGAAGGCAAAAACCTCCCTACGAGGGCGCTTGCCAGCAAAGTCCACGGGCAG
ACATAGAGACGCTGAGTAGAGTTCGTCACTGCAAGGGCAGGCGTGCAGACGAGCTCGGTCTTCCTGCGTCAGACTGTCCTCCAACAGCTCCGCCGCGTTG
TACACTGGGACAGAGCGAGAGACGCATTCAGTTGCCAGTACtagtaccagcagcagcagcacagccgCAGCAAGCGAGGGTAGACGCAGAATCATGCTCT
TGAATTTTGGGTACATCGTACCATTCCATCTGCAAACAGAGGGAAAAAGATCGTGCGCAAAACGTATCTTTCGGTGGTCGACCTCTTTGTGTCCCTTCAT
GCGCACAGTTGCAGAAACGAGTCTAGTGAAAAACATGGCGGGGGCTAGCAATGCGCTCATGATGAGCATGGGGACGGTGGCTATGTGGGGGTTCTCGCCT
GCTTTTGACGTGTACAGCGGCTTGCCGGAGTGGAGCAGCCAGGGTTTTGCAGCTTCGGTCGCTTCGAGTGACGCCACCGCACCGATCAACATTTTTCTGG
CGGGGCCTGGGGATGTGCGCCACGTGCTGGCGACTATCGtgcgccgccgccgatgGGAGCCAGCCATGAAGAACCGACCAGTGCACATCTACTTGTTTGA
AAAGGCTATCGAGACGCTTGCGCGAGACTTACTGTTGATTCAAATCGCACTCGACACGAATCTTCCGTTGcggcagcgctgcaacaCGTTCCTGGAGATC
TTTGGGAATGCTCGGGTGCAGGTAGGTCGTCGgggtggaagaagagcgatgCAGCAAGGGTATTGACTGTGGAATTGTGATGTGCGTGCAGGAGAGGACG
AGCGCTTACATCGAAGAGcaggcgaagaagctgatAGATTTCATCTGTAATGACCGCGGTCCATTGACAGGCCTAGTAGATAATTCACACTTGAAGATGC
GCACTCACGACGATCTCATCGACGTGTTCCGAAGCTGGTTTCAGAGTGTCAAGTTTGATGGTATACTGGAATTTTTAAGAACGGAAAAATTGGCTCTAAC
TAACCGTGTTCTGGTTTGCAGTTGACTCCCTTCGGGATCATCGCCTTCGACACTACTACGAAGTTCGCTACGACTATCGCGACAACCTGATCGACTGGGA
CTACACCGTACATCGTCCTTAAGCCTTGTGGATTCCGATGCTCTGGTGCTCACTCTTGGTTTGCGTTCtagatgaagctcaagaaaatTGAGAATGCTAG
TGTGATTCACATTCGACAGTATCGCGATTGGAGAAACTCTGGCGTGGCATTTGAATTCGGCGATCAGACCTACATAATGCCAAATCGCACCATGGCAGCA
TACACAGAGGTACATGGTCGCTGTTTTAGCGTCGATCGTGTAAAACTCGTGAGTCTCATTCTGATACGTTTTCTTATGGACAGGCAACGAAGAAACACCA
CGGATCTGTGCTCTGCAGAGGCTTATGGACAGACATCATTGTGAGTCCATACATTTCGTTTGGTGTTCACTGTGAGAATTCCAGCAAATTTGTAGAGCAG
CTGTTCGAGATTCACAACAAGGGCACGGGAGTCGAACAGAATCGCCATGTAAGTTATAGTTGTCTATCCCGCTTTTACTTCGGTCTTTATTGACGAATTT
GATGTAACAGAACACCGGAGAAGTTGCCATGTACAATGTACTATCGTATTTGTACGAGATCGAGACTGGCAACAAGTATCAGATGGAAAAAGTACAGAAC
ACCCTTCAGCCGCGTATTCGTTTGCATGCACTAACGCTACAGATTGGTATACTAGGAACACGACATTTTCAGCGGAATTGGCGATACGGAGGGAGCACGC
GCTGGTACTGGCAATCTGCAAGCACCAGATAAGCCAGTCCCGCGGTTCGAAGAGTTGGGTGAGGACACTACCGAAGCGTAAGTGCAGTGTTGCGTCTTTT
GATTTCTGTCATATTGGCAACTACACTAATCAATTTTCCTGGGCAGTGAAATCTTTAAGCAGGAACCAGCACAGGCTACATCTCAACAACGTGTTAAAAC
GACCCTGGAGGGTGTGAAGGTGGAGGCTACACTTTCCAAGCACTTGCAACGACAAGTTTTCCTGACTGAATAGTGTTACTTTGTCTCTATCGCAGATCAT
TCCGTTGACAGGTAGCCTGGAGGACCTTTTTTCAAAAAAGCGCTACACCAACCTATTCGACTACGCCTTCGTTTCGTCCCAGCAATGCCACGTGTTTCAA
CCCCATGAGGACGTGGagcagcaaacagcaagaaTGTTCACAAACATTTTGAAGGATGGTGCGACTGTAGACGTTGAGTCTTCAGTGTAAGTACATCTTA
TTATTATTTGCTTCCGTATGGAGCGACGATAAATATTGACGTTCCTGGGTGTACAGCTTCATGCTACCTCTCAAGCAAGAGCAAAGGACACACTATGTGA
CGAAACTACAAGAGTGGACATCACACCATTCGCTGAAGCCCACGTTTGACTTTGGAGGCAAGAATGAGCCTTCCACCGAAGACATGATCAAGATTAAAAA
CGCTGTGCTACGGTTTAACTA