Description :
From Genome Similarity Track
Location :
contig_13:235264- 236681
Transcript NameFunction/comments
g2413.t1kinesin family-like protein

Sequence
1417 bases(100 bases per row)
GCCGACTCGCTCAGCACGATCTGTCCGCCTTGCCCCAACTCGCTCATCTCGCGCGCCATCATCTCGCTGGGCCCCAGGTACGTCATCTTGCCTGTCGTGG
GGTGGCGCGCGCACACCAACCGCTCGTCGCCGTCGTGGATGGCCATGCGCACGCGCAGTCCGTTAAATAACAGCCGCGCCCAGACATCGTACACGCGCGA
GGCGTTGTCGAATTTGAGCAGCGGCGCCGGCCACGCCGCCTTCAACAACTTCTCTTGGACGCTGACGCACCACCCGATGGCGTCGCGCACGCACTGAAAC
GCGAGCTGGAACGAGTCGCCCGCGGTTGTGATCTCGTAGCCTCGGAAGCGAGGCAGCTCTTGACGGAGTAAGTCGTCGTGGATCGACTGCGCGCCTGGGC
GTCGCCGGCCCAAAGCCGACTGGAGCCTTCAATGTCGGTCACGACGAAAATCGGTCGCCGGACAGGCGCTTCCACGATCACGTCGAGCGAGTTGAACCCG
TCTTGGAAAAAGCCGCCTTCGAGGAGCTGCTCGTAGACTGAAGTTGGCATCAAAGGACGCAGCGTGCGGTAGCAGCAAGTGACGCTGATGCCGATCGCGA
AGGCTGTGCCTGCGCCGGACAAGTAGTAAGTGATCTGCGTGAGCCCGACCCACTCCATGCTGAGGTCGATGACGCGCACCAGCACCTCGACGACGCAGGA
CGGGAACACGAGCACGCAGTACACGATCACGAACGTCTTGATACGCTGGTGCAGCAGCAGCGACGCAGGGTCCACCGCTCGCCGCGTCCGCTTCCGACGC
GAGATCCATATCGTGACGTACACCGGGTACAGCACGGACGCCCAGATGCAGGCCAACTCGAACCAAAAGGCAGCGGTCTGCACGCGCTCCGACTTGGTGG
ACGGCAGGAACGCCGAAACGGCCATCAAAATGGCAAACACCACGGCCGCGATGCACGCGCGCAGGCAATACTGCCGGATGATGGCGCGCTCGCGCGTGGG
TCCGCGGTCCATGGACTTGATGATGAGGCGCTTCATCTCGTACGCTAACGTAGTGATGAAAAAGGTCGTGCACAGCAGAGCGCAGTCTCCGACCAGCGTG
ACGGTCACGGCGATGGCCTTGAACTGCTTTCCGTCCGAGTAGACTGCGCGCGCGCCCATGAGCTCGCCATCGTCGAGCGCGTCCAAGGTGTCTCGCAGTC
CGTCGAAATTGACGAGCACGCCCACGTAGAGCAGCAGTCGAGCGAGCGAGTAGACGAAGGACAATCGACACACCGAGTACGTGATGTACTGCACGGCCGA
GTCGCCCACCTTAATGTGCTTGAACGAGAGCAGCAGCGTCGTGGCCGTCGTGGCCGTGGCAATCGCCAACACGATCACATACGTCAGAGTCCAGTCGTAG
TGGGTCGAGTCATCCAT