Description :
From Genome Similarity Track
Location :
Scaffold_58:235171- 236787
Transcript NameFunction/comments
Sapdi_VS20SDRG_13323hypothetical protein

Sequence
1616 bases(100 bases per row)
CTGACCGAAGTTGAACATGGGAGCGTTGGAAGTATCTGTGCCAAACATAAACTGGTCGTTCTGTACCGCGGGCGCGGCCATGTCGCTTTCAACTTCTTCG
CCTTGGAAAAAGCGCTCGATGATCGTCATCGACTTGTTGTAAATGTCTATGTGGGTATGCATGCATGCATTCGGTTCCACACGATATCATCAAGTATACC
TTCACTCTCGCTGTACTGGAGCATCTGGATCTTCTCGACACCATCGCACTCGTCGACGAGGTTGGAGAACGCGTTCACAAATGTTTGGTTGGCTTGGCCT
TCCTCTTCACCAATGCGCAAAATGTTCTCAAGGCCTTCGAGTGCGACTGTAATGACCTTGGCGTCGTGCAAGTCGAGAAGACTGCAGAGTGCGCCGATAC
AGCCTACAAGAGTCCGGCACTTGCATGCGACGTAAAGGCGGCGCACCAAAAAAGACCAGTTGCTTGATCTGGAGCGAACTGCCACCGGACGTTGCGTTCG
AGATGGCCCATGCCGCTTCCTTGCGGATGTCGAACTCCGTCTACAGTGATAACTCGTCAGCAGATCGAGAGCGATGACTGGGGCGTACCGAGGCGCCAAG
ATACTGAATGAGCACGGGGAAGATATCAGCGTCCATAATGTTCTGGATCTGCTGGGTGTTGCCGGCCGTAATGTTGGAGATCGTCCAGCATGCTTCCTTG
CGAATGCCCTTCTTTGGCGACTCGAGCAGCGCGCGCAGGCACGGCAAAACGTTTAAGTTGATCATGACCTGCGTCTGGATGTCGTTGCCCGTCACGATGT
TACCAACCGTGCGCAGCGCCGGGGTCTGAACCGACGGCGAGCGGTGCATGAGCAGCTCAACAATACGGCGACAGACGCCTGCCTCGATGACCGCCTGGAT
TTGCGGGTTTTCGCCATCCGAGAGGTAGCTCAGCGCCCAGCACGCATCCGTGAGAACTTCGTCGTCTTGCGTCAAGATGAGCTGTGCAAGCGTCTGCAAC
GCTGGGCGTACACTACAACGATGCAAAATTAGAACAAATTTGGGCTGAAACATTGTACTCGTCAAAGCGTGGCTTGGGCTTGCCGCGGCAAAAGTTGGAG
AGCGTCCACGTCGCGTTGCGCAGCATCGTGGTCTTTGAGTTCGACGTTAGCTGCTGCATGAGTGGCCGCAGTGCGTTGCAGCTCAGAACGATGTCGCGGC
ACTGAGCAGAGTCGCCAGCAATGTTGCCGAGCGCCCAAACAGCCTGCTCGCGCACGTCGTCGTTCGGCGAGAGAAGCAGTTGACAGAAGATGGGCACGGC
GCCGCTGCTAATGACCGTACGGGTGTGGTCTGACGTACCAGAGGCGATGTTTGTGAGCGCCCAAGCTGCCTCGAACTGCAAACTCGGGTAGTCCTCGCGC
TTCAAGAGTTCGACGAAGACTGGCACGACCCCAAGCTTGATGACTTCTTCAATCGGAGGGTTCTTCTCTATAGCACGAGTTTGACGATTTTTCGATGACA
TTCATAGCGTTACCAATCGAAAGGAGCTTGCGAAACTTGCTCACAGACGCGAGCTGGACCTCCGAGTCGGGGCTCTGCAGGTTCATGCACATCTGCGGCA
ACTCGGCAAGCTACAA