Description :
From Genome Similarity Track
Location :
Scaffold_91:23513- 28350
Sequence
4837 bases(100 bases per row)
TTTCAGCCAAAATTCTTCTTTTGGCTAATAGCTGTGAAGCTGTAGCTCCACTACACTCGGTAGCGCTTGTAGTTAATCCTACATTTGGCACTCGGCGACC
GACGCTCTGAAAATATGTTAAAACTCGCTCACCTCTATCAGGATCAAGGACTCGCGCTGGATACCCTTGCAGCGTCAAGTGAGTTCGAACACATCGACCT
CATTATGGCCAAAGGCCTGAAAGTGTTAAACGCACATCTGGAAGCATTTGTGCAACTTGAAGCCACGTTAATTGGCCAGGTATAATGATCATGTCGCGTC
GCCCATGCCAACGCACTACACCCCAGTGTTCGGTGAAGTTCCAAGGTCTCATCTGCTTAATTTAAGCTTTCAGACTTTTGAAGGGAAAGAGGGGGAATTT
GTGTTCCTCTGGATCCGTAATTTGAATTGCCATGAGCGCCTCTATGCTCAGGTCAGAACTGCAACTAGTTGGCATGGTCATTTTCAAGGTTGTTATCAGG
TCCAGGAAATGGACACTACCTGCAATGCTTCTCTAATAGCCGCGTTTCCCACAAAGAATTGTTTATGGGACAAGTGTCTTGCGTGCTCACGCCACCTATC
CAGGCATATCGTGTACACTCCTGCTTCCTAGCATCTCATACCCAGGATGGAATTATTCGACTATTATTAAGAGTTGAGGGTTCTCGTCACTGGTATGCAG
TTGGACACGCTTTCAAAGGAAGTACGTACGACCATTTTATGGAAAACCTTCGCACTGGAGTCAGCGGGACGGAAGTCTTCCGTGTCCAGCCTTCTACCTT
CGCGCAGGCATTCATACTGAACTCGGCAGTATGAATGCCGAGTTCAACTTCAGCGCGGCTCTCTATGGTACTCATAGGTATACTTGATTTTCTTCGATAT
GCTCAATCCCATGGACTTCATCTGTGCTGAAAGTGAAGAATCTGAGCTTGAAGATGTGGAACAGCAACATAAAATTCGTTAATGCTACACTCGTGGGCGC
ACAAGACCTCTCCGCCCATTTTCCCGCTTCTGAAGCTGCGTCGGAATCGACTTAGCCATAATCATACTTCGAGCCCGAGAACGGGAACGGCGCGGGAAAA
CGTCGATTATTAGTAGTCGCGAAGCAGCCTACTGAAGAAGAACAAGATCAGTAGAGTCTTTAGGACCTCAAGGCGAATAAGTATCAGCCCCAAATTACTT
CGTGGAAGTTACCACGAAGCGTGGATTCAAACCATGCGTGTTAGATATGTAGGCGACCGTTAATATGGTTTACGAAAGCCGTGGTCGTTTCTCGTTGACT
CAGTGGCAAAGGGAAATAATTCTTGTCGCTGTTCCTCGAAAGAGATTCAGCAATAAGCTGTGGTGCTAAAAGCGCATATGTGTGATTGTATCACGGTCCA
TCGAGCAACTACGGTACGTTTTACCTTTCATAAAACTTCGCTCAAGTTAGGTGTAATACAGCATCGAACGCTGTCTCATCCTAGTATCTTTGTATCGCTG
GGAGGTCTAATAGCTTAGGCGGCACGTGCGACGTTTCCAGCGGGACTGTAATGCGCCTTGCATTCACCATCGCTTAAAACAACAGCCCTGTTGACACGAG
AGACTGACCGGGACAATTAAAGTGATGGGTATTGGACTGTTTGAATAAAAGACTTCGATGTCGATCATAGTGCTCGTCGACGCGTAGTAAAATGGCACGT
ACTCTTTTGAGTGACACTCGTAGTGATAAAAAGTCTCTGAATACTTCAGGAAGGCATTTTTGGCTTCGAGCAGAGTCATCAAGAGTGTGATCTCTCTAAA
GAGGCACTTATAAATTCATTGAGTACAGGTAGCTTGGATATCACCTCACTGGATGTATTTGGTGGCATCGGTTCTCAGTAAGATCAAGTTAAGGTTCAAG
AGTCTAATAGCCTTGGTGGTGGTACTCTCTGCATCTATAAAAGAAGTACGCATCTTCAGTGATCCAGCAGCGTCTCTACATGGCTGTTGCGATACGTTAG
GCGTCAGTTTATATGCAACGCAGTAATACTAGCAACCTAATATATACACGATTCGACAGAGTGGTAGGCGATGTTGATGTGAAGTCGACCCTATCCGAAT
ATCATCGTTTAGCTCTCTGTTTGAGCTAGACATTATGTGTGGGGATGACTATCATTGGCCTTTACGACCGGTGGTTTATCCGATATTGTGGTTCTTAAAC
ATGATCTTGGGTCAAATTTTATGGCCGCTTTTAAATGAGAGAGTGCTCTAAAAGAACCAATTGTGGCACTTCGTACAAGAATCGGATCTCGTATTTTTCA
ATAATACTTCGGATTCGTATTATCCTTTGGTGTATTGATACAAGGACGTGGTGTGTCATAATATACCGCCCGTGTTACCTCCTGATATTGGTGTAATTCA
TGGGTTAACCTTGGTCCCGCGGACTGAATACTGCGTTACACGGCAGTGGGCATTGTGTCGGGACCGTGTGATGTCAGTGAAGAAGTGTTATGTGCAAAGC
GTGCGGTAGATATGGTGCATGATAGCAAATCTTCACGCTCAGCACCGACCTTCTCTGATAATGAAACGAATTGGCAAGTGTCGCTTTGTCTATGCTTGTA
ATCGGCTTAATGCGAACATTAATATAGTCTAGACACCGATAACAAACAAGGAAGTTTTTCGATATATATGATTGGTTATACCATGTACTACATACTGGAC
CTAGTCGATTGTCATTACGAATTTGTTATGCTAGCGAGCAATTTGCGCTCACAGCATTTCGTTCACCGAGCCGATTGCTCTTTAAGTTTCTATCTATTCA
CAAGGGGTTTGTAGTGCTCCGGATACTATTAGTCGTCTAGGGACTCAACTCGCCCGAACTCATAGAGCGTATGATCCATTAATGACATCTCTTTCCATTA
GCGTGCAGAACAGAAAAGCCAGATATGTAAAATCACCTCGGTAATTTACGAGGGTGATCGAGTGTATCCGAACGAACTTTCTATATGCTAATGCATCAAT
TTGAATCTTTAAGGCGGGATCAATTCCGTTTCTGGGATACTTCATTATCGAAAATATCCTTCGTGGGTATCCCGCAAAAGGTAAAAACCATCGTGGATTG
GTCGGTACCTATAAAGCAAAATGACTTAAAAATGGCTTGGACTTTTCAATTACTTGCACAAGTGCAGCGAGAGCTATGCTGATATGTCGTAGCCATTGCA
CGATCGACTTAATAGGGATGAAGTGGTTTTGGTACGCCAAAGGTGATGAAGTCTATAAAGCAGTGAAAACAGTCTTTTCCACGCCCCGATTCTGGCTCTT
CCAGATTCTAGTCGATCTCTAATGTCGTCTATGATGCATTCGACTTTGACATAGGCAGTGGATTGCTACAAACAGACCTGATTGCGATAGAGTGCATAAT
CGCATTATAGTCTCGTCAGATAAAAGCTGCTATAAGTAACCACACAGCTTATACCAAAGAACCATTTGCAATGAAATATGTTTCAGTCAATTTAAGAGTT
CAACTACTTGGTTCTAAGCCTTTTGAGGTCTCTGCCAATCATGTATCTTTCGCACAGCGACTTTGTCGACCTTATCGATTTCGATAGATATCTATATGAA
GTTATTTCTCTGCCGCATATAACTTTGAGGCGAAATATAAGTCGGGTGAGCAAAATACTTCGGCGGATTCGTTGTCTTGAAGACCTGATCATAACTTATT
CATTTCACCCATCGTCGTTGTAGATCATGGATACTTTTTGTACTGCTTATGCAAACGATGAAACTATGTGCTCTCAGAAGCGAGGGGTACAGAGACTCGT
ACTTAATTGTCGGCTTGACTGCATGGGTGAATACATCAATATTACACAATGAGAGCTTTTGTTCTATTGTAAATACGCACCAAACCCACCTCACATGGTA
GTTCCTCTTAATTCAACAAATCATCTATGAGGCGCAGTACACAGCAATTTTAAGTCATTTTGAGTATGATAAGACATATGGCTCATTATGAAAACGTTAC
TGGTGGTCCCCGCTCTACAAAAAGATGATTACATACGTTAGTGCGCGTAAACGTGTCAACGGGCCATACTTAAGCACCATACGGCGTCGCCGCTCGATAT
AATTACTGCTTCCACTGGCTGTTGGAATTCTATTAGTATCGACTTTGTGTTGAATCTACCCAAGTGTTTGCACAGCAACGCGAGTTTTGTGACCATTTGA
ACAATATGAATCATTAAACAGCTGTGTCGGATAAATATGATGGTGGTTGTACAGCACAGCTGTTTATCAATCAAGTCTTTCGTTAACATGGCCTGCTTGT
AGCAATTATCGCTGACCAATATCCTCGTATCATAAAAAGAAATGGAAGTTCATTTTCCAAGTTCTCTGGACACGATAAGTCATTACCGCAACGAATAGTA
CGCTGACCGATAGCCAACCTATAAGCATTGATCGCTTTATTAACTGCTTTTTACGCTAAGTGTTTGCTGATAAACCACGTAGTTGGTGCTCAATACTCCT
TGTCGTTTAGTTTGCACTCAGCAGCTATGTACAAGCCTTCAATGGTATACTTCGTTAAATGTGGACGACCTCACGCAACCACGCATTCCGTTGACTTTAT
CACTCTGTGGTCGGTTCTTGATGAGGAAGATTTTGTCGTTCGGCTTGGTCTTGTCATCCCTGCTGTTATTCAAGGCACTTGTGAGCGCTTTTTTCGCTAC
GCGATCAAGTGTCTTAAGATATGTGCGTGATGTGATGTCTGAAAGCCACGACAAACAACGAAAAAAGGAGACTAAATATTTAAGTTGTATTAAGAGTTAT
GCGACCAGAGACCAATTCTCACTAAATGCTAAAAATC