Description :
From Genome Similarity Track
Location :
Scaffold_44:23512- 25477
Transcript NameFunction/comments
Physo_136201reverse transcriptase

Sequence
1965 bases(100 bases per row)
AGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTTTCAACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTTCCGGAAGA
GATTCCTGCGGAGCTTCCGCAGGATAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGA
GAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGTCA
AGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGTTATCAT
CGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTGTCACGGCTGTG
AGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCT
CGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCG
GAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTCGGG
AAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCA
CGTACTTGTCCAAGTACATGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGAGTGGGTTTGGACTGCTGAGTGTCAGCA
GGCCTTCGATGCAATCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTATGTGACGCATCCGACTTC
ACAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGG
TACATGACAAGGAGCTCCTTGCCATGAAGTATGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTACCCAGACCACACGTC
GCTGCGGACAGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGA
AGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCAACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATACGATCGAGCACCCCAA
CGTCGTCACTGTTGGGCGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTCA
GAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGTGCACGACGGGTTATTACTCTACACTGCAGTCGACGACAACGCGGACCGCGTTGTC
GTGCCCAATGACCATGACCTGCGACTCAGGATCATGTACGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCA
CGCGAGACTTCTACTGGGCCCACCAGTACAAATGGGCGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGC
TCCCTTGCAGTCACTACCAACTCCACGAGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCG