Description :
From Genome Similarity Track
Location :
Scaffold_75:2351- 4201
Sequence
1850 bases(100 bases per row)
GGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCAC
TTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCGTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCA
CGAAGAGGCTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTTGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGA
TTTTCATTGCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGGCGCGGGGCGCCCTGCTGGTCCCTCTGGGTTTTTTAATAGCCTGTGAC
GATACCCAGTATCGCCACGACGGCTATTCGTCGCGTGCACAGGTGCTGTGTACTCGCGGGCGTAGTGACCGACGTTTCCGCAGCGGAAACAATGCACATT
CGTTGATCCACGACGGTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCAGGACCTCCCGTCGGCCTTGCCACCGGTCGTGGCATCAGC
CGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGA
GATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCG
TGCTCTTTGAGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGT
TTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACA
TGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGCCCCCCTCTCTCTTCC
AACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATG
AAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGGTGGAGGGCCT
CCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTT
CTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTT
AAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGCAGGAGTAATTTACTTAAGTTCAGTATACTTGTATTCACAAGTATACTTAAACCTAGATAAATGA
ACCAAACGAAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATG
GCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGG
TGGTCACCTGAATGTATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG