Description :
From Genome Similarity Track
Location :
Scaffold_17:23509- 24818
Sequence
1309 bases(100 bases per row)
ACGCAGACAAGTCGCAAGAAGCATGCGACTCCGAGCTCTAGTCGCTCAGGAAGAATGAGACGTGGGAATTTTTGCCATTACCGCGCGATCGCAAGTGGGT
TTTCAAGGTCAAGGAGAACCAAGATGGTGAGATCGAGCGATTTAAGGCGCGCCTAGTCGCAAAAGGTTTCCTAAAGAAGTATGGCATCGATTTTGAGCAG
ACTTTCGCTCCTGTTGCCAAGTTCGCGTCAACCCGGATCATCCTAAGTCTTGCCGCACAGTACAAGCTCGTGCTGCATCAGATGGATGTCAAGACCGCGT
TCCTGAACGGATTTCTTGAGAAAGATATTTATATGAGACAACCTGTAGGATTTTTCGACTCCACCATCCTAATCATGTTTGTAAGCTCAAAGCGCCTTAT
ACGGTCTCAAGGAGTCGCCTCGCATGTGGAATCAGACCATCGACGAAGCTATGATGTTCGTGGTTCTCGACGTCGACGATTTGATACTCCCATGCAACGA
CATTAATTTGCTGTCGGCGACCAAGCAAACGCTGAGTGAGCGCTTCGAGATGTCCGATCTCGGCGAACTAAAGTACTGCCTTGGAATGGAAGTAGAGCGT
GATGACAAGTCGGGCGATGTGTCGATGCGGCAGACCAAATTCCTGCGGTCGGTCCTGACCAAGTTCGGAATGAAAGACTGCAAGCCTGTGAAAACTCCGC
AGGACCCCAGTCTTAAGCCAACAAAAACATGTGCGGTGGTGGATGCATTCACGACGAAACCATGAAGGGTGTGCCGTACTGCAATGCTGTTGGAGCCGTG
ATGTACCTCATGGTTGGTACTCGTCCAGACCTTGCAGCAGCTGTAGGGATGCTAAGCCAGTTTGCTGCCGATCCGTGTCTGACACATTGGAAAGTCCCAA
GGCGAGTCTTCAGGTACCTGAAAGCGACACCGACACACGGCATCTGTTACTCCGGATCCGACAACTGATCGTCCACTCGGATACCGATTGAGCTGGCGAC
ATCGAGACTCGACACAGCACAAGCGGATATGTGTTCCTGCTTAACGGCAGTTGCATTAGCTGGCACAGCAAGCAGCAGCGCACTGTGGCTCTATCATCGA
CTGATGCAGAGTATATGCCTTTATCTGGAGGATATTCAAGAAGCAGTGTGGATCAAGGCCTTCATGCACGATCTTGATGAAGATGCAGGAAACGGCGCCA
TAAAGGTATTTGAAGACAACCAAGGAGTGATAGCGTTGGCCAAGAACCCTGAGTTCCACAAGCGCACCAAGCACATCGACATCCGCTACAACGTTTTGCG
TGAGAAGGT